Incidental Mutation 'R6371:Ms4a6b'
ID513548
Institutional Source Beutler Lab
Gene Symbol Ms4a6b
Ensembl Gene ENSMUSG00000024677
Gene Namemembrane-spanning 4-domains, subfamily A, member 6B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6371 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location11516512-11531256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11520364 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 9 (E9G)
Ref Sequence ENSEMBL: ENSMUSP00000124685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025580] [ENSMUST00000161157] [ENSMUST00000161283] [ENSMUST00000163078]
Predicted Effect probably damaging
Transcript: ENSMUST00000025580
AA Change: E9G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025580
Gene: ENSMUSG00000024677
AA Change: E9G

DomainStartEndE-ValueType
Pfam:CD20 47 204 2.8e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159587
Predicted Effect possibly damaging
Transcript: ENSMUST00000161157
AA Change: E9G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125519
Gene: ENSMUSG00000024677
AA Change: E9G

DomainStartEndE-ValueType
Pfam:CD20 47 117 8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161283
SMART Domains Protein: ENSMUSP00000124277
Gene: ENSMUSG00000024677

DomainStartEndE-ValueType
Pfam:CD20 1 69 9.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163078
AA Change: E9G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124685
Gene: ENSMUSG00000024677
AA Change: E9G

DomainStartEndE-ValueType
Pfam:CD20 47 204 4.2e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189628
Meta Mutation Damage Score 0.4235 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,274 S237L probably damaging Het
Ank3 T G 10: 69,808,879 L58V probably damaging Het
Arsb A T 13: 93,790,066 I115F possibly damaging Het
Atad2b T C 12: 4,973,970 Y32H probably damaging Het
Brd1 A C 15: 88,713,998 M515R probably benign Het
Cbx7 A G 15: 79,918,822 S30P possibly damaging Het
Cdk12 A G 11: 98,245,288 T1123A unknown Het
Cep170b A G 12: 112,740,945 D375G probably damaging Het
Clcn3 T C 8: 60,937,335 K164E probably benign Het
Clip4 A C 17: 71,856,464 K677T probably damaging Het
Clrn2 T C 5: 45,460,198 I137T possibly damaging Het
Cntln T C 4: 84,884,579 S39P probably damaging Het
Crocc2 T A 1: 93,215,631 N1318K probably benign Het
Emc1 C T 4: 139,371,665 Q820* probably null Het
Fam71e2 A G 7: 4,759,359 V257A probably benign Het
Fbxl2 G A 9: 113,989,383 T170I probably damaging Het
Fyb2 A G 4: 104,995,778 T552A probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hspg2 T C 4: 137,541,695 Y2213H probably damaging Het
Ifnar2 T C 16: 91,388,098 Y24H possibly damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Itgb2 C A 10: 77,548,597 P184H probably damaging Het
Kcnb2 T A 1: 15,711,212 D769E probably benign Het
Lrp1b A G 2: 40,851,654 M3087T possibly damaging Het
Ltbp3 A G 19: 5,745,772 probably null Het
Nat3 G A 8: 67,524,179 probably null Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nop58 T G 1: 59,711,312 probably benign Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Olfr285 A G 15: 98,313,338 Y71H possibly damaging Het
P3h4 C T 11: 100,411,749 E354K probably benign Het
Plekhm2 T G 4: 141,629,532 T787P possibly damaging Het
Ppia C T 11: 6,418,230 T37I probably benign Het
Reln T A 5: 21,995,513 M1330L probably benign Het
Ric1 A G 19: 29,562,026 E53G probably benign Het
Sgip1 T A 4: 102,966,285 V721E probably damaging Het
Slc33a1 A T 3: 63,943,288 D538E probably benign Het
Son T C 16: 91,674,741 Het
Srebf1 A T 11: 60,203,515 S591R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Taok2 G A 7: 126,870,147 R1170W probably damaging Het
Tsc2 A T 17: 24,626,714 V210E probably benign Het
Ttc6 T A 12: 57,728,463 N1648K possibly damaging Het
Vgll3 C T 16: 65,839,245 P94L probably damaging Het
Vmn2r54 A T 7: 12,615,435 V740E probably damaging Het
Yeats2 A G 16: 20,221,710 E1127G possibly damaging Het
Zfp709 T A 8: 71,889,485 Y252N probably damaging Het
Other mutations in Ms4a6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ms4a6b APN 19 11529490 missense possibly damaging 0.72
IGL01373:Ms4a6b APN 19 11529507 missense possibly damaging 0.71
IGL03258:Ms4a6b APN 19 11521708 missense probably damaging 1.00
R0443:Ms4a6b UTSW 19 11521680 missense possibly damaging 0.95
R0616:Ms4a6b UTSW 19 11526898 critical splice donor site probably null
R1649:Ms4a6b UTSW 19 11520442 missense possibly damaging 0.94
R1826:Ms4a6b UTSW 19 11523934 missense probably damaging 1.00
R3964:Ms4a6b UTSW 19 11521734 missense probably benign 0.01
R3966:Ms4a6b UTSW 19 11521734 missense probably benign 0.01
R5380:Ms4a6b UTSW 19 11521680 missense probably damaging 1.00
R5862:Ms4a6b UTSW 19 11521803 missense probably benign 0.13
R5922:Ms4a6b UTSW 19 11520379 missense possibly damaging 0.94
R6048:Ms4a6b UTSW 19 11520370 missense possibly damaging 0.62
R6120:Ms4a6b UTSW 19 11521695 missense probably benign 0.24
R7057:Ms4a6b UTSW 19 11526889 missense possibly damaging 0.79
R7253:Ms4a6b UTSW 19 11520396 missense probably benign 0.26
R7516:Ms4a6b UTSW 19 11529543 missense probably benign
R7543:Ms4a6b UTSW 19 11521791 missense not run
R7645:Ms4a6b UTSW 19 11523940 missense probably damaging 1.00
Z1176:Ms4a6b UTSW 19 11529486 critical splice acceptor site probably null
Z1177:Ms4a6b UTSW 19 11520423 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GTGCTGTGTACTCTGATCATGC -3'
(R):5'- ACATAGAGCCTCACCCTCTG -3'

Sequencing Primer
(F):5'- TATCCAACACTATCCAACTTTGCATC -3'
(R):5'- TGCCCTCTACCCACCCCAG -3'
Posted On2018-04-27