Mutagenetix > Incidental Mutations

Incidental Mutation 'R6371:Ric1'

513549

Institutional Source

Beutler Lab

Gene Symbol

Ric1

Ensembl Gene

ENSMUSG00000038658

Gene Name

RAB6A GEF complex partner 1

Synonyms

C030046E11Rik, C130057E09Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.411) question?

Stock #

R6371 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

29522282-29606829 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29562026 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 53 (E53G)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043610] [ENSMUST00000162184]

Predicted Effect

probably benign
Transcript: ENSMUST00000043610
AA Change: E125G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000043437
Gene: ENSMUSG00000038658
AA Change: E125G

Domain	Start	End	E-Value	Type
Blast:WD40	242	278	5e-7	BLAST
SCOP:d1gxra_	254	379	2e-4	SMART
Blast:WD40	285	334	3e-6	BLAST
Blast:WD40	482	520	5e-6	BLAST
low complexity region	642	653	N/A	INTRINSIC
Pfam:RIC1	732	991	1.9e-86	PFAM
low complexity region	1120	1132	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160221

Predicted Effect

probably benign
Transcript: ENSMUST00000162184
AA Change: E125G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000162492
AA Change: E53G

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000124727
Gene: ENSMUSG00000038658
AA Change: E53G

Domain	Start	End	E-Value	Type
Blast:WD40	171	207	4e-7	BLAST
SCOP:d1gxra_	183	308	2e-4	SMART
Blast:WD40	214	263	2e-6	BLAST
low complexity region	534	545	N/A	INTRINSIC
Pfam:RIC1	624	883	1.6e-86	PFAM
low complexity region	1012	1024	N/A	INTRINSIC

Meta Mutation Damage Score

0.0868

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.2%
20x: 94.1%

Validation Efficiency

98% (50/51)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6b	C	T	12: 113,490,274	S237L	probably damaging	Het
Ank3	T	G	10: 69,808,879	L58V	probably damaging	Het
Arsb	A	T	13: 93,790,066	I115F	possibly damaging	Het
Atad2b	T	C	12: 4,973,970	Y32H	probably damaging	Het
Brd1	A	C	15: 88,713,998	M515R	probably benign	Het
Cbx7	A	G	15: 79,918,822	S30P	possibly damaging	Het
Cdk12	A	G	11: 98,245,288	T1123A	unknown	Het
Cep170b	A	G	12: 112,740,945	D375G	probably damaging	Het
Clcn3	T	C	8: 60,937,335	K164E	probably benign	Het
Clip4	A	C	17: 71,856,464	K677T	probably damaging	Het
Clrn2	T	C	5: 45,460,198	I137T	possibly damaging	Het
Cntln	T	C	4: 84,884,579	S39P	probably damaging	Het
Crocc2	T	A	1: 93,215,631	N1318K	probably benign	Het
Emc1	C	T	4: 139,371,665	Q820*	probably null	Het
Fam71e2	A	G	7: 4,759,359	V257A	probably benign	Het
Fbxl2	G	A	9: 113,989,383	T170I	probably damaging	Het
Fyb2	A	G	4: 104,995,778	T552A	probably damaging	Het
Gm2381	G	A	7: 42,820,586	A38V	probably benign	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
Helz2	C	T	2: 181,233,467	E1745K	probably damaging	Het
Hspg2	T	C	4: 137,541,695	Y2213H	probably damaging	Het
Ifnar2	T	C	16: 91,388,098	Y24H	possibly damaging	Het
Inpp5d	T	A	1: 87,699,675	L566Q	probably damaging	Het
Itgb2	C	A	10: 77,548,597	P184H	probably damaging	Het
Kcnb2	T	A	1: 15,711,212	D769E	probably benign	Het
Lrp1b	A	G	2: 40,851,654	M3087T	possibly damaging	Het
Ltbp3	A	G	19: 5,745,772		probably null	Het
Ms4a6b	A	G	19: 11,520,364	E9G	probably damaging	Het
Nat3	G	A	8: 67,524,179		probably null	Het
Ndufaf1	A	T	2: 119,660,053	D175E	probably damaging	Het
Nop58	T	G	1: 59,711,312		probably benign	Het
Olfr122	A	G	17: 37,772,435	T261A	probably benign	Het
Olfr285	A	G	15: 98,313,338	Y71H	possibly damaging	Het
P3h4	C	T	11: 100,411,749	E354K	probably benign	Het
Plekhm2	T	G	4: 141,629,532	T787P	possibly damaging	Het
Ppia	C	T	11: 6,418,230	T37I	probably benign	Het
Reln	T	A	5: 21,995,513	M1330L	probably benign	Het
Sgip1	T	A	4: 102,966,285	V721E	probably damaging	Het
Slc33a1	A	T	3: 63,943,288	D538E	probably benign	Het
Son	T	C	16: 91,674,741			Het
Srebf1	A	T	11: 60,203,515	S591R	probably damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Taok2	G	A	7: 126,870,147	R1170W	probably damaging	Het
Tsc2	A	T	17: 24,626,714	V210E	probably benign	Het
Ttc6	T	A	12: 57,728,463	N1648K	possibly damaging	Het
Vgll3	C	T	16: 65,839,245	P94L	probably damaging	Het
Vmn2r54	A	T	7: 12,615,435	V740E	probably damaging	Het
Yeats2	A	G	16: 20,221,710	E1127G	possibly damaging	Het
Zfp709	T	A	8: 71,889,485	Y252N	probably damaging	Het

Other mutations in Ric1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00574:Ric1	APN	19	29595362	missense	probably damaging	1.00
IGL00902:Ric1	APN	19	29567231	missense	probably benign	0.05
IGL01405:Ric1	APN	19	29567370	splice site	probably benign
IGL01629:Ric1	APN	19	29603981	missense	probably benign	0.02
IGL01688:Ric1	APN	19	29577614	missense	probably benign	0.00
IGL01966:Ric1	APN	19	29595563	missense	probably benign	0.33
IGL02123:Ric1	APN	19	29594800	missense	probably benign
IGL02590:Ric1	APN	19	29567481	splice site	probably benign
IGL02655:Ric1	APN	19	29595451	missense	probably damaging	1.00
IGL02699:Ric1	APN	19	29522557	missense	possibly damaging	0.51
IGL02718:Ric1	APN	19	29533240	missense	probably damaging	1.00
IGL03026:Ric1	APN	19	29599833	missense	probably benign	0.02
IGL03142:Ric1	APN	19	29600980	missense	possibly damaging	0.89
R0109:Ric1	UTSW	19	29586677	synonymous	silent
R0336:Ric1	UTSW	19	29587793	missense	probably damaging	0.96
R0362:Ric1	UTSW	19	29601011	critical splice donor site	probably null
R0676:Ric1	UTSW	19	29577647	missense	probably benign
R0734:Ric1	UTSW	19	29594818	missense	possibly damaging	0.66
R1004:Ric1	UTSW	19	29602357	missense	probably benign	0.00
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1216:Ric1	UTSW	19	29577735	missense	probably benign	0.00
R1493:Ric1	UTSW	19	29579849	missense	probably benign
R1848:Ric1	UTSW	19	29600813	splice site	probably null
R1872:Ric1	UTSW	19	29602668	missense	probably benign	0.32
R1942:Ric1	UTSW	19	29601016	splice site	probably benign
R2143:Ric1	UTSW	19	29533252	missense	probably damaging	1.00
R2143:Ric1	UTSW	19	29533253	missense	probably damaging	0.96
R2679:Ric1	UTSW	19	29604030	missense	probably benign
R2878:Ric1	UTSW	19	29602330	missense	possibly damaging	0.77
R2970:Ric1	UTSW	19	29577718	missense	probably benign	0.15
R3420:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3421:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3940:Ric1	UTSW	19	29570762	missense	probably damaging	1.00
R4004:Ric1	UTSW	19	29579801	missense	probably benign	0.44
R4225:Ric1	UTSW	19	29602731	missense	possibly damaging	0.89
R4280:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4283:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4516:Ric1	UTSW	19	29570765	missense	probably benign	0.17
R4702:Ric1	UTSW	19	29598017	missense	possibly damaging	0.85
R4824:Ric1	UTSW	19	29585842	missense	probably damaging	1.00
R4835:Ric1	UTSW	19	29595536	missense	possibly damaging	0.80
R5860:Ric1	UTSW	19	29599845	missense	possibly damaging	0.91
R5883:Ric1	UTSW	19	29595989	missense	probably damaging	1.00
R5965:Ric1	UTSW	19	29570771	missense	probably damaging	0.99
R6141:Ric1	UTSW	19	29595442	missense	probably damaging	1.00
R6236:Ric1	UTSW	19	29595426	missense	possibly damaging	0.91
R6271:Ric1	UTSW	19	29567365	splice site	probably null
R6345:Ric1	UTSW	19	29604085	missense	probably benign	0.09
R6547:Ric1	UTSW	19	29594826	missense	probably damaging	1.00
R6924:Ric1	UTSW	19	29569388	missense	probably damaging	0.98
R6969:Ric1	UTSW	19	29585782	missense	probably damaging	1.00
R6970:Ric1	UTSW	19	29587772	missense	probably damaging	1.00
R6993:Ric1	UTSW	19	29586613	missense	probably damaging	1.00
R7296:Ric1	UTSW	19	29584578	critical splice donor site	probably null
R7434:Ric1	UTSW	19	29574780	missense	probably damaging	1.00
R7619:Ric1	UTSW	19	29579775	missense	probably benign	0.32
R7850:Ric1	UTSW	19	29594893	missense	probably benign
R7941:Ric1	UTSW	19	29533259	missense	probably damaging	1.00
R8115:Ric1	UTSW	19	29586573	missense	probably damaging	1.00
R8117:Ric1	UTSW	19	29574791	missense	probably benign	0.08
R8477:Ric1	UTSW	19	29597783	missense	probably damaging	1.00
X0064:Ric1	UTSW	19	29587802	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCGTATGGAATGAAACATTGC -3'
(R):5'- TCCAAGAAACACATGGAGGC -3'

Sequencing Primer
(F):5'- CCTAGGTAGGAAAGCACTCTTAGTC -3'
(R):5'- AACACATGGAGGCTGCAG -3'

Posted On

2018-04-27