Incidental Mutation 'R6372:Tecpr1'
ID 513567
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Name tectonin beta-propeller repeat containing 1
Synonyms 2210010N04Rik
MMRRC Submission 044522-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6372 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 144131260-144160433 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 144153776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 159 (R159Q)
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085701]
AlphaFold Q80VP0
Predicted Effect probably damaging
Transcript: ENSMUST00000085701
AA Change: R159Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: R159Q

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196360
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T A 10: 87,066,088 (GRCm39) H136Q possibly damaging Het
Aim2 T A 1: 173,282,802 (GRCm39) probably null Het
Atp13a3 T C 16: 30,162,273 (GRCm39) H696R probably damaging Het
Atrnl1 T C 19: 57,638,764 (GRCm39) S301P probably benign Het
Atxn1 T A 13: 45,710,932 (GRCm39) I667F probably damaging Het
Cacnb4 T A 2: 52,324,679 (GRCm39) Y415F probably benign Het
Ccdc183 T C 2: 25,506,176 (GRCm39) D140G probably benign Het
Clec2g A C 6: 128,925,726 (GRCm39) H45P probably benign Het
Col5a3 A G 9: 20,696,882 (GRCm39) V917A probably damaging Het
Cryga T C 1: 65,142,204 (GRCm39) Y63C probably damaging Het
Dnajc28 T C 16: 91,414,176 (GRCm39) I23V probably benign Het
Elovl6 T C 3: 129,426,751 (GRCm39) F139S probably damaging Het
Fcgbp A G 7: 27,806,433 (GRCm39) T2134A probably damaging Het
Fcrl5 C T 3: 87,351,501 (GRCm39) Q250* probably null Het
Gimap1 T A 6: 48,720,290 (GRCm39) *301K probably null Het
Gm17472 T C 6: 42,957,823 (GRCm39) S31P possibly damaging Het
Gm2381 G A 7: 42,470,010 (GRCm39) A38V probably benign Het
Gnl1 T C 17: 36,293,427 (GRCm39) F204S probably damaging Het
Helz2 C T 2: 180,875,260 (GRCm39) E1745K probably damaging Het
Hk1 T C 10: 62,127,757 (GRCm39) H370R probably benign Het
Ighv7-2 G A 12: 113,876,075 (GRCm39) T10I probably benign Het
Itga9 A G 9: 118,726,389 (GRCm39) K448E probably damaging Het
Lama4 C A 10: 38,943,948 (GRCm39) N750K probably benign Het
Megf11 T C 9: 64,613,907 (GRCm39) Y1077H probably damaging Het
Mrpl45 T C 11: 97,212,388 (GRCm39) probably benign Het
Nbeal2 T C 9: 110,457,812 (GRCm39) D2185G possibly damaging Het
Ncoa3 C T 2: 165,901,267 (GRCm39) S953F possibly damaging Het
Nlrc5 T C 8: 95,206,378 (GRCm39) L743P probably damaging Het
Nol4 A G 18: 23,171,613 (GRCm39) probably null Het
Nol9 T C 4: 152,130,452 (GRCm39) S329P probably damaging Het
Ntrk1 T C 3: 87,693,355 (GRCm39) D259G probably benign Het
Or2y11 A G 11: 49,442,757 (GRCm39) Y61C probably damaging Het
Or4k40 T A 2: 111,251,147 (GRCm39) I50F probably benign Het
Or5al5 T C 2: 85,961,198 (GRCm39) T270A possibly damaging Het
Or5d16 T C 2: 87,773,319 (GRCm39) T218A probably benign Het
Or8h8 T A 2: 86,753,499 (GRCm39) I126F probably damaging Het
Pbx4 C A 8: 70,324,694 (GRCm39) A365E possibly damaging Het
Pcdhb19 T A 18: 37,630,419 (GRCm39) N71K probably benign Het
Pde2a G A 7: 101,130,599 (GRCm39) A80T probably benign Het
Psmb5 C A 14: 54,854,130 (GRCm39) R116L probably damaging Het
Recql A G 6: 142,322,566 (GRCm39) V112A probably damaging Het
Rhbdl3 C A 11: 80,221,482 (GRCm39) L207I probably damaging Het
Rtkn A G 6: 83,128,882 (GRCm39) D459G possibly damaging Het
Rubcnl C A 14: 75,285,009 (GRCm39) S509R probably damaging Het
Slc26a8 T C 17: 28,863,777 (GRCm39) T661A probably benign Het
Sspo A T 6: 48,449,475 (GRCm39) D2472V probably damaging Het
Taf4b T G 18: 14,937,790 (GRCm39) V258G probably damaging Het
Tbc1d19 T G 5: 54,014,252 (GRCm39) S293R possibly damaging Het
Tlr3 A G 8: 45,850,048 (GRCm39) S874P probably damaging Het
Tnk2 T A 16: 32,498,603 (GRCm39) W639R probably damaging Het
Tpmt C T 13: 47,189,370 (GRCm39) probably null Het
Trappc9 T A 15: 72,461,923 (GRCm39) D935V possibly damaging Het
Trav13d-4 T C 14: 53,995,118 (GRCm39) V4A probably damaging Het
Ubn1 C T 16: 4,899,502 (GRCm39) T1082I possibly damaging Het
Usf2 G A 7: 30,654,738 (GRCm39) Q35* probably null Het
Vmn1r57 T C 7: 5,223,826 (GRCm39) M117T possibly damaging Het
Vmn2r65 G T 7: 84,589,861 (GRCm39) A685E probably damaging Het
Vxn G A 1: 9,683,546 (GRCm39) E45K probably damaging Het
Zeb2 T C 2: 44,892,551 (GRCm39) E166G probably damaging Het
Zfp808 T C 13: 62,320,291 (GRCm39) S507P probably damaging Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144,145,411 (GRCm39) critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144,148,358 (GRCm39) missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144,153,737 (GRCm39) missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144,134,806 (GRCm39) splice site probably benign
IGL02244:Tecpr1 APN 5 144,146,821 (GRCm39) missense probably benign
IGL02247:Tecpr1 APN 5 144,143,372 (GRCm39) missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144,140,305 (GRCm39) missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144,143,364 (GRCm39) missense probably benign 0.28
larghissimo UTSW 5 144,154,075 (GRCm39) missense probably damaging 1.00
PIT4531001:Tecpr1 UTSW 5 144,150,885 (GRCm39) missense probably damaging 0.96
R0121:Tecpr1 UTSW 5 144,147,017 (GRCm39) missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144,134,717 (GRCm39) missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144,155,335 (GRCm39) missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144,144,294 (GRCm39) missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144,132,759 (GRCm39) missense probably benign
R0504:Tecpr1 UTSW 5 144,150,899 (GRCm39) missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144,143,092 (GRCm39) missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144,154,219 (GRCm39) missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144,149,408 (GRCm39) missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144,148,317 (GRCm39) missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144,150,871 (GRCm39) splice site probably null
R0835:Tecpr1 UTSW 5 144,149,410 (GRCm39) missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144,153,747 (GRCm39) missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144,143,357 (GRCm39) missense possibly damaging 0.77
R1597:Tecpr1 UTSW 5 144,151,128 (GRCm39) missense probably benign 0.00
R1663:Tecpr1 UTSW 5 144,134,762 (GRCm39) missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144,145,426 (GRCm39) missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144,143,347 (GRCm39) missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144,141,515 (GRCm39) missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2133:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144,148,274 (GRCm39) missense probably benign 0.10
R2172:Tecpr1 UTSW 5 144,133,235 (GRCm39) missense probably damaging 1.00
R2290:Tecpr1 UTSW 5 144,150,881 (GRCm39) missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144,146,797 (GRCm39) missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144,143,077 (GRCm39) missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144,149,408 (GRCm39) missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144,144,255 (GRCm39) missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144,150,935 (GRCm39) missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144,141,476 (GRCm39) missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144,154,075 (GRCm39) missense probably damaging 1.00
R5043:Tecpr1 UTSW 5 144,134,672 (GRCm39) splice site probably null
R5459:Tecpr1 UTSW 5 144,144,234 (GRCm39) missense probably damaging 1.00
R5579:Tecpr1 UTSW 5 144,151,162 (GRCm39) missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144,155,451 (GRCm39) nonsense probably null
R5679:Tecpr1 UTSW 5 144,144,241 (GRCm39) missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144,143,364 (GRCm39) missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144,148,239 (GRCm39) missense probably benign 0.02
R6022:Tecpr1 UTSW 5 144,136,009 (GRCm39) missense possibly damaging 0.95
R6114:Tecpr1 UTSW 5 144,141,458 (GRCm39) missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144,135,394 (GRCm39) missense probably damaging 0.97
R6493:Tecpr1 UTSW 5 144,146,792 (GRCm39) missense probably benign
R7276:Tecpr1 UTSW 5 144,153,838 (GRCm39) nonsense probably null
R7314:Tecpr1 UTSW 5 144,154,150 (GRCm39) missense probably damaging 1.00
R7375:Tecpr1 UTSW 5 144,145,417 (GRCm39) missense possibly damaging 0.68
R7632:Tecpr1 UTSW 5 144,155,544 (GRCm39) missense probably benign 0.03
R7702:Tecpr1 UTSW 5 144,140,236 (GRCm39) missense probably damaging 1.00
R8135:Tecpr1 UTSW 5 144,135,420 (GRCm39) missense probably damaging 0.99
R8406:Tecpr1 UTSW 5 144,137,658 (GRCm39) missense probably damaging 1.00
R8844:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8856:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8857:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8866:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8903:Tecpr1 UTSW 5 144,150,845 (GRCm39) intron probably benign
R8926:Tecpr1 UTSW 5 144,153,780 (GRCm39) missense probably damaging 1.00
R9218:Tecpr1 UTSW 5 144,154,049 (GRCm39) missense possibly damaging 0.70
R9423:Tecpr1 UTSW 5 144,155,396 (GRCm39) missense probably damaging 0.98
RF001:Tecpr1 UTSW 5 144,154,204 (GRCm39) missense probably damaging 0.99
Z1176:Tecpr1 UTSW 5 144,155,409 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GTTAAAGGCAAGGTCCCAGG -3'
(R):5'- CCTGCTCCGGGATTGAATAC -3'

Sequencing Primer
(F):5'- GTATGGTGTACCCTTTGGCCC -3'
(R):5'- TGCTCCGGGATTGAATACCATAC -3'
Posted On 2018-04-27