Incidental Mutation 'R6372:1700113H08Rik'
ID513589
Institutional Source Beutler Lab
Gene Symbol 1700113H08Rik
Ensembl Gene ENSMUSG00000047129
Gene NameRIKEN cDNA 1700113H08 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6372 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location87058045-87230589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87230226 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 136 (H136Q)
Ref Sequence ENSEMBL: ENSMUSP00000140447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169849] [ENSMUST00000189456] [ENSMUST00000189775]
Predicted Effect probably benign
Transcript: ENSMUST00000169849
AA Change: H256Q

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000130852
Gene: ENSMUSG00000047129
AA Change: H256Q

DomainStartEndE-ValueType
Pfam:DUF4607 71 325 2.1e-113 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000189456
AA Change: H136Q

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140447
Gene: ENSMUSG00000047129
AA Change: H136Q

DomainStartEndE-ValueType
Pfam:DUF4607 45 206 6.2e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000189775
AA Change: H90Q

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141184
Gene: ENSMUSG00000047129
AA Change: H90Q

DomainStartEndE-ValueType
Pfam:DUF4607 6 160 6.8e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219879
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110035E14Rik G A 1: 9,613,321 E45K probably damaging Het
Aim2 T A 1: 173,455,236 probably null Het
Atp13a3 T C 16: 30,343,455 H696R probably damaging Het
Atrnl1 T C 19: 57,650,332 S301P probably benign Het
Atxn1 T A 13: 45,557,456 I667F probably damaging Het
Cacnb4 T A 2: 52,434,667 Y415F probably benign Het
Ccdc183 T C 2: 25,616,164 D140G probably benign Het
Clec2g A C 6: 128,948,763 H45P probably benign Het
Col5a3 A G 9: 20,785,586 V917A probably damaging Het
Cryga T C 1: 65,103,045 Y63C probably damaging Het
Dnajc28 T C 16: 91,617,288 I23V probably benign Het
Elovl6 T C 3: 129,633,102 F139S probably damaging Het
Fcgbp A G 7: 28,107,008 T2134A probably damaging Het
Fcrl5 C T 3: 87,444,194 Q250* probably null Het
Gimap1 T A 6: 48,743,356 *301K probably null Het
Gm17472 T C 6: 42,980,889 S31P possibly damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gnl1 T C 17: 35,982,535 F204S probably damaging Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hk1 T C 10: 62,291,978 H370R probably benign Het
Ighv7-2 G A 12: 113,912,455 T10I probably benign Het
Itga9 A G 9: 118,897,321 K448E probably damaging Het
Lama4 C A 10: 39,067,952 N750K probably benign Het
Megf11 T C 9: 64,706,625 Y1077H probably damaging Het
Mrpl45 T C 11: 97,321,562 probably benign Het
Nbeal2 T C 9: 110,628,744 D2185G possibly damaging Het
Ncoa3 C T 2: 166,059,347 S953F possibly damaging Het
Nlrc5 T C 8: 94,479,750 L743P probably damaging Het
Nol4 A G 18: 23,038,556 probably null Het
Nol9 T C 4: 152,045,995 S329P probably damaging Het
Ntrk1 T C 3: 87,786,048 D259G probably benign Het
Olfr1039 T C 2: 86,130,854 T270A possibly damaging Het
Olfr1098 T A 2: 86,923,155 I126F probably damaging Het
Olfr1155 T C 2: 87,942,975 T218A probably benign Het
Olfr1286 T A 2: 111,420,802 I50F probably benign Het
Olfr1381 A G 11: 49,551,930 Y61C probably damaging Het
Pbx4 C A 8: 69,872,044 A365E possibly damaging Het
Pcdhb19 T A 18: 37,497,366 N71K probably benign Het
Pde2a G A 7: 101,481,392 A80T probably benign Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Recql A G 6: 142,376,840 V112A probably damaging Het
Rhbdl3 C A 11: 80,330,656 L207I probably damaging Het
Rtkn A G 6: 83,151,901 D459G possibly damaging Het
Rubcnl C A 14: 75,047,569 S509R probably damaging Het
Slc26a8 T C 17: 28,644,803 T661A probably benign Het
Sspo A T 6: 48,472,541 D2472V probably damaging Het
Taf4b T G 18: 14,804,733 V258G probably damaging Het
Tbc1d19 T G 5: 53,856,910 S293R possibly damaging Het
Tecpr1 C T 5: 144,216,958 R159Q probably damaging Het
Tlr3 A G 8: 45,397,011 S874P probably damaging Het
Tnk2 T A 16: 32,679,785 W639R probably damaging Het
Tpmt C T 13: 47,035,894 probably null Het
Trappc9 T A 15: 72,590,074 D935V possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,661 V4A probably damaging Het
Ubn1 C T 16: 5,081,638 T1082I possibly damaging Het
Usf2 G A 7: 30,955,313 Q35* probably null Het
Vmn1r57 T C 7: 5,220,827 M117T possibly damaging Het
Vmn2r65 G T 7: 84,940,653 A685E probably damaging Het
Zeb2 T C 2: 45,002,539 E166G probably damaging Het
Zfp808 T C 13: 62,172,477 S507P probably damaging Het
Other mutations in 1700113H08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:1700113H08Rik APN 10 87165123 missense probably damaging 1.00
IGL01764:1700113H08Rik APN 10 87074046 start codon destroyed probably benign 0.02
IGL02173:1700113H08Rik APN 10 87225892 missense possibly damaging 0.63
IGL02756:1700113H08Rik APN 10 87165108 missense probably damaging 0.99
IGL03202:1700113H08Rik APN 10 87074047 start codon destroyed probably null 0.35
IGL03393:1700113H08Rik APN 10 87074038 utr 5 prime probably benign
R0255:1700113H08Rik UTSW 10 87226045 missense probably damaging 1.00
R0409:1700113H08Rik UTSW 10 87225954 missense probably damaging 0.98
R0744:1700113H08Rik UTSW 10 87165069 missense probably damaging 1.00
R0833:1700113H08Rik UTSW 10 87165069 missense probably damaging 1.00
R1163:1700113H08Rik UTSW 10 87121422 missense probably damaging 0.99
R2128:1700113H08Rik UTSW 10 87230204 missense possibly damaging 0.94
R2129:1700113H08Rik UTSW 10 87230204 missense possibly damaging 0.94
R4108:1700113H08Rik UTSW 10 87225934 missense probably damaging 1.00
R5541:1700113H08Rik UTSW 10 87225946 missense probably benign 0.00
R6345:1700113H08Rik UTSW 10 87226051 missense probably benign 0.43
R6710:1700113H08Rik UTSW 10 87226061 missense probably benign 0.00
R6971:1700113H08Rik UTSW 10 87165041 missense possibly damaging 0.91
R7055:1700113H08Rik UTSW 10 87226221 missense probably damaging 0.99
R7713:1700113H08Rik UTSW 10 87230311 missense possibly damaging 0.80
R7808:1700113H08Rik UTSW 10 87121435 missense probably benign 0.33
R7838:1700113H08Rik UTSW 10 87206199 splice site probably null
R8293:1700113H08Rik UTSW 10 87226002 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGAGACCTTTTACCGCCATTGG -3'
(R):5'- GGGCTTCGAAAGACTCTGTG -3'

Sequencing Primer
(F):5'- CTCTGCAGAAGTGTCAGTCAG -3'
(R):5'- GACTCTGTGAACAAGCCTTATGG -3'
Posted On2018-04-27