Incidental Mutation 'R6372:Zfp808'
ID513596
Institutional Source Beutler Lab
Gene Symbol Zfp808
Ensembl Gene ENSMUSG00000074867
Gene Namezinc finger protein 808
SynonymsGm7036
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6372 (G1)
Quality Score187.009
Status Validated
Chromosome13
Chromosomal Location62129886-62236144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62172477 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 507 (S507P)
Ref Sequence ENSEMBL: ENSMUSP00000097048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099449] [ENSMUST00000221772]
Predicted Effect probably damaging
Transcript: ENSMUST00000099449
AA Change: S507P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097048
Gene: ENSMUSG00000074867
AA Change: S507P

DomainStartEndE-ValueType
KRAB 4 66 2.1e-17 SMART
ZnF_C2H2 133 155 2.4e-3 SMART
ZnF_C2H2 161 183 8.34e-3 SMART
ZnF_C2H2 189 211 2.75e-3 SMART
ZnF_C2H2 217 239 1.98e-4 SMART
ZnF_C2H2 245 267 3.21e-4 SMART
ZnF_C2H2 273 295 2.43e-4 SMART
ZnF_C2H2 301 323 8.6e-5 SMART
ZnF_C2H2 329 351 4.54e-4 SMART
ZnF_C2H2 357 379 9.22e-5 SMART
ZnF_C2H2 385 407 8.22e-2 SMART
ZnF_C2H2 413 435 1.56e-2 SMART
ZnF_C2H2 441 463 5.99e-4 SMART
ZnF_C2H2 469 491 2.79e-4 SMART
ZnF_C2H2 497 519 4.54e-4 SMART
ZnF_C2H2 525 547 1.95e-3 SMART
ZnF_C2H2 553 575 4.24e-4 SMART
ZnF_C2H2 581 603 2.27e-4 SMART
ZnF_C2H2 609 631 2.27e-4 SMART
ZnF_C2H2 637 659 9.08e-4 SMART
ZnF_C2H2 665 687 1.4e-4 SMART
ZnF_C2H2 693 715 4.24e-4 SMART
ZnF_C2H2 721 743 1.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221542
Predicted Effect probably benign
Transcript: ENSMUST00000221772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223094
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T A 10: 87,230,226 H136Q possibly damaging Het
3110035E14Rik G A 1: 9,613,321 E45K probably damaging Het
Aim2 T A 1: 173,455,236 probably null Het
Atp13a3 T C 16: 30,343,455 H696R probably damaging Het
Atrnl1 T C 19: 57,650,332 S301P probably benign Het
Atxn1 T A 13: 45,557,456 I667F probably damaging Het
Cacnb4 T A 2: 52,434,667 Y415F probably benign Het
Ccdc183 T C 2: 25,616,164 D140G probably benign Het
Clec2g A C 6: 128,948,763 H45P probably benign Het
Col5a3 A G 9: 20,785,586 V917A probably damaging Het
Cryga T C 1: 65,103,045 Y63C probably damaging Het
Dnajc28 T C 16: 91,617,288 I23V probably benign Het
Elovl6 T C 3: 129,633,102 F139S probably damaging Het
Fcgbp A G 7: 28,107,008 T2134A probably damaging Het
Fcrl5 C T 3: 87,444,194 Q250* probably null Het
Gimap1 T A 6: 48,743,356 *301K probably null Het
Gm17472 T C 6: 42,980,889 S31P possibly damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gnl1 T C 17: 35,982,535 F204S probably damaging Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hk1 T C 10: 62,291,978 H370R probably benign Het
Ighv7-2 G A 12: 113,912,455 T10I probably benign Het
Itga9 A G 9: 118,897,321 K448E probably damaging Het
Lama4 C A 10: 39,067,952 N750K probably benign Het
Megf11 T C 9: 64,706,625 Y1077H probably damaging Het
Mrpl45 T C 11: 97,321,562 probably benign Het
Nbeal2 T C 9: 110,628,744 D2185G possibly damaging Het
Ncoa3 C T 2: 166,059,347 S953F possibly damaging Het
Nlrc5 T C 8: 94,479,750 L743P probably damaging Het
Nol4 A G 18: 23,038,556 probably null Het
Nol9 T C 4: 152,045,995 S329P probably damaging Het
Ntrk1 T C 3: 87,786,048 D259G probably benign Het
Olfr1039 T C 2: 86,130,854 T270A possibly damaging Het
Olfr1098 T A 2: 86,923,155 I126F probably damaging Het
Olfr1155 T C 2: 87,942,975 T218A probably benign Het
Olfr1286 T A 2: 111,420,802 I50F probably benign Het
Olfr1381 A G 11: 49,551,930 Y61C probably damaging Het
Pbx4 C A 8: 69,872,044 A365E possibly damaging Het
Pcdhb19 T A 18: 37,497,366 N71K probably benign Het
Pde2a G A 7: 101,481,392 A80T probably benign Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Recql A G 6: 142,376,840 V112A probably damaging Het
Rhbdl3 C A 11: 80,330,656 L207I probably damaging Het
Rtkn A G 6: 83,151,901 D459G possibly damaging Het
Rubcnl C A 14: 75,047,569 S509R probably damaging Het
Slc26a8 T C 17: 28,644,803 T661A probably benign Het
Sspo A T 6: 48,472,541 D2472V probably damaging Het
Taf4b T G 18: 14,804,733 V258G probably damaging Het
Tbc1d19 T G 5: 53,856,910 S293R possibly damaging Het
Tecpr1 C T 5: 144,216,958 R159Q probably damaging Het
Tlr3 A G 8: 45,397,011 S874P probably damaging Het
Tnk2 T A 16: 32,679,785 W639R probably damaging Het
Tpmt C T 13: 47,035,894 probably null Het
Trappc9 T A 15: 72,590,074 D935V possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,661 V4A probably damaging Het
Ubn1 C T 16: 5,081,638 T1082I possibly damaging Het
Usf2 G A 7: 30,955,313 Q35* probably null Het
Vmn1r57 T C 7: 5,220,827 M117T possibly damaging Het
Vmn2r65 G T 7: 84,940,653 A685E probably damaging Het
Zeb2 T C 2: 45,002,539 E166G probably damaging Het
Other mutations in Zfp808
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Zfp808 APN 13 62173209 missense probably damaging 0.96
IGL02517:Zfp808 APN 13 62173218 makesense probably null
IGL02809:Zfp808 APN 13 62173180 missense probably benign 0.00
IGL02882:Zfp808 APN 13 62173180 missense probably benign 0.00
IGL02941:Zfp808 APN 13 62173130 missense possibly damaging 0.82
IGL03184:Zfp808 APN 13 62169567 missense possibly damaging 0.90
LCD18:Zfp808 UTSW 13 62166651 intron probably benign
R0387:Zfp808 UTSW 13 62169478 missense probably damaging 1.00
R0472:Zfp808 UTSW 13 62172306 missense probably damaging 1.00
R0544:Zfp808 UTSW 13 62169434 splice site probably benign
R0635:Zfp808 UTSW 13 62172419 missense probably damaging 1.00
R0981:Zfp808 UTSW 13 62171673 missense possibly damaging 0.47
R1446:Zfp808 UTSW 13 62173007 missense probably damaging 1.00
R1569:Zfp808 UTSW 13 62172900 nonsense probably null
R1573:Zfp808 UTSW 13 62171497 missense possibly damaging 0.52
R1761:Zfp808 UTSW 13 62171646 missense possibly damaging 0.71
R1796:Zfp808 UTSW 13 62171856 missense probably damaging 1.00
R1993:Zfp808 UTSW 13 62172907 missense probably benign 0.10
R2656:Zfp808 UTSW 13 62172852 missense possibly damaging 0.63
R2938:Zfp808 UTSW 13 62171218 missense probably benign
R3027:Zfp808 UTSW 13 62171590 missense probably benign 0.33
R3777:Zfp808 UTSW 13 62171903 missense probably damaging 0.97
R3779:Zfp808 UTSW 13 62171903 missense probably damaging 0.97
R3801:Zfp808 UTSW 13 62172083 missense probably damaging 1.00
R3802:Zfp808 UTSW 13 62172083 missense probably damaging 1.00
R3804:Zfp808 UTSW 13 62172083 missense probably damaging 1.00
R4024:Zfp808 UTSW 13 62171730 missense possibly damaging 0.71
R4741:Zfp808 UTSW 13 62171949 missense probably damaging 1.00
R4791:Zfp808 UTSW 13 62171231 missense probably damaging 0.97
R4809:Zfp808 UTSW 13 62171292 nonsense probably null
R4907:Zfp808 UTSW 13 62171473 missense possibly damaging 0.71
R5056:Zfp808 UTSW 13 62172630 missense probably damaging 1.00
R5760:Zfp808 UTSW 13 62171926 missense probably damaging 1.00
R5869:Zfp808 UTSW 13 62171255 missense probably damaging 1.00
R6230:Zfp808 UTSW 13 62172322 missense probably benign 0.19
R6545:Zfp808 UTSW 13 62171895 missense probably benign 0.02
R6620:Zfp808 UTSW 13 62172824 missense probably benign 0.08
R6622:Zfp808 UTSW 13 62171832 missense possibly damaging 0.90
R6813:Zfp808 UTSW 13 62173035 missense probably damaging 0.99
R6920:Zfp808 UTSW 13 62173168 missense probably benign 0.05
R7511:Zfp808 UTSW 13 62172823 missense probably benign
R7666:Zfp808 UTSW 13 62171411 missense probably benign
R7747:Zfp808 UTSW 13 62171505 missense probably benign 0.39
R7763:Zfp808 UTSW 13 62172664 missense probably benign 0.28
R7779:Zfp808 UTSW 13 62172757 missense possibly damaging 0.68
RF005:Zfp808 UTSW 13 62171299 missense probably benign 0.14
RF024:Zfp808 UTSW 13 62171299 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AAGCCTTTTCCCATAACTATCACCT -3'
(R):5'- CAGAAAAGGCTTTATCACATTGATC -3'

Sequencing Primer
(F):5'- CAGTGTGATAAAGCCTTTTCTGAG -3'
(R):5'- AAAGGGTTTCTCTCCACTATGTG -3'
Posted On2018-04-27