Incidental Mutation 'R6372:Taf4b'
ID 513607
Institutional Source Beutler Lab
Gene Symbol Taf4b
Ensembl Gene ENSMUSG00000054321
Gene Name TATA-box binding protein associated factor 4b
Synonyms Taf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock # R6372 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 14783245-14900359 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 14804733 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 258 (V258G)
Ref Sequence ENSEMBL: ENSMUSP00000126909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169862]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000169862
AA Change: V258G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: V258G

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
Pfam:TAFH 257 348 5.3e-39 PFAM
low complexity region 359 376 N/A INTRINSIC
low complexity region 412 422 N/A INTRINSIC
Pfam:TAF4 610 852 4e-72 PFAM
Meta Mutation Damage Score 0.8042 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T A 10: 87,230,226 H136Q possibly damaging Het
3110035E14Rik G A 1: 9,613,321 E45K probably damaging Het
Aim2 T A 1: 173,455,236 probably null Het
Atp13a3 T C 16: 30,343,455 H696R probably damaging Het
Atrnl1 T C 19: 57,650,332 S301P probably benign Het
Atxn1 T A 13: 45,557,456 I667F probably damaging Het
Cacnb4 T A 2: 52,434,667 Y415F probably benign Het
Ccdc183 T C 2: 25,616,164 D140G probably benign Het
Clec2g A C 6: 128,948,763 H45P probably benign Het
Col5a3 A G 9: 20,785,586 V917A probably damaging Het
Cryga T C 1: 65,103,045 Y63C probably damaging Het
Dnajc28 T C 16: 91,617,288 I23V probably benign Het
Elovl6 T C 3: 129,633,102 F139S probably damaging Het
Fcgbp A G 7: 28,107,008 T2134A probably damaging Het
Fcrl5 C T 3: 87,444,194 Q250* probably null Het
Gimap1 T A 6: 48,743,356 *301K probably null Het
Gm17472 T C 6: 42,980,889 S31P possibly damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gnl1 T C 17: 35,982,535 F204S probably damaging Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hk1 T C 10: 62,291,978 H370R probably benign Het
Ighv7-2 G A 12: 113,912,455 T10I probably benign Het
Itga9 A G 9: 118,897,321 K448E probably damaging Het
Lama4 C A 10: 39,067,952 N750K probably benign Het
Megf11 T C 9: 64,706,625 Y1077H probably damaging Het
Mrpl45 T C 11: 97,321,562 probably benign Het
Nbeal2 T C 9: 110,628,744 D2185G possibly damaging Het
Ncoa3 C T 2: 166,059,347 S953F possibly damaging Het
Nlrc5 T C 8: 94,479,750 L743P probably damaging Het
Nol4 A G 18: 23,038,556 probably null Het
Nol9 T C 4: 152,045,995 S329P probably damaging Het
Ntrk1 T C 3: 87,786,048 D259G probably benign Het
Olfr1039 T C 2: 86,130,854 T270A possibly damaging Het
Olfr1098 T A 2: 86,923,155 I126F probably damaging Het
Olfr1155 T C 2: 87,942,975 T218A probably benign Het
Olfr1286 T A 2: 111,420,802 I50F probably benign Het
Olfr1381 A G 11: 49,551,930 Y61C probably damaging Het
Pbx4 C A 8: 69,872,044 A365E possibly damaging Het
Pcdhb19 T A 18: 37,497,366 N71K probably benign Het
Pde2a G A 7: 101,481,392 A80T probably benign Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Recql A G 6: 142,376,840 V112A probably damaging Het
Rhbdl3 C A 11: 80,330,656 L207I probably damaging Het
Rtkn A G 6: 83,151,901 D459G possibly damaging Het
Rubcnl C A 14: 75,047,569 S509R probably damaging Het
Slc26a8 T C 17: 28,644,803 T661A probably benign Het
Sspo A T 6: 48,472,541 D2472V probably damaging Het
Tbc1d19 T G 5: 53,856,910 S293R possibly damaging Het
Tecpr1 C T 5: 144,216,958 R159Q probably damaging Het
Tlr3 A G 8: 45,397,011 S874P probably damaging Het
Tnk2 T A 16: 32,679,785 W639R probably damaging Het
Tpmt C T 13: 47,035,894 probably null Het
Trappc9 T A 15: 72,590,074 D935V possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,661 V4A probably damaging Het
Ubn1 C T 16: 5,081,638 T1082I possibly damaging Het
Usf2 G A 7: 30,955,313 Q35* probably null Het
Vmn1r57 T C 7: 5,220,827 M117T possibly damaging Het
Vmn2r65 G T 7: 84,940,653 A685E probably damaging Het
Zeb2 T C 2: 45,002,539 E166G probably damaging Het
Zfp808 T C 13: 62,172,477 S507P probably damaging Het
Other mutations in Taf4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Taf4b APN 18 14844420 missense probably damaging 1.00
IGL01755:Taf4b APN 18 14897985 missense probably benign
IGL01755:Taf4b APN 18 14897986 missense probably benign 0.13
IGL02049:Taf4b APN 18 14830139 missense probably benign 0.00
IGL02650:Taf4b APN 18 14841983 nonsense probably null
IGL03078:Taf4b APN 18 14813554 missense possibly damaging 0.48
IGL03169:Taf4b APN 18 14821535 missense probably damaging 1.00
IGL03261:Taf4b APN 18 14821528 missense probably benign
adirondack UTSW 18 14804578 missense probably null 0.16
R0266:Taf4b UTSW 18 14813077 splice site probably benign
R0385:Taf4b UTSW 18 14783760 missense probably benign 0.00
R1015:Taf4b UTSW 18 14813098 missense probably damaging 1.00
R1054:Taf4b UTSW 18 14821473 missense probably benign 0.00
R1416:Taf4b UTSW 18 14821427 splice site probably benign
R1435:Taf4b UTSW 18 14807409 missense probably damaging 1.00
R1609:Taf4b UTSW 18 14835881 missense probably damaging 1.00
R1611:Taf4b UTSW 18 14844469 missense probably null 1.00
R1906:Taf4b UTSW 18 14822102 missense probably benign 0.00
R2038:Taf4b UTSW 18 14807399 missense probably damaging 1.00
R2890:Taf4b UTSW 18 14804792 missense probably damaging 1.00
R4527:Taf4b UTSW 18 14821442 missense probably damaging 1.00
R4559:Taf4b UTSW 18 14813526 missense probably damaging 1.00
R4773:Taf4b UTSW 18 14804520 missense probably benign 0.30
R4857:Taf4b UTSW 18 14804578 missense probably null 0.16
R4946:Taf4b UTSW 18 14813542 missense probably damaging 1.00
R4984:Taf4b UTSW 18 14835816 missense probably damaging 1.00
R4994:Taf4b UTSW 18 14898043 missense probably damaging 0.99
R5010:Taf4b UTSW 18 14822172 missense possibly damaging 0.59
R5155:Taf4b UTSW 18 14830095 missense probably benign 0.07
R5874:Taf4b UTSW 18 14804554 missense probably benign
R6079:Taf4b UTSW 18 14822198 missense possibly damaging 0.75
R6303:Taf4b UTSW 18 14807355 missense probably damaging 1.00
R6304:Taf4b UTSW 18 14807355 missense probably damaging 1.00
R6972:Taf4b UTSW 18 14813347 missense possibly damaging 0.86
R7538:Taf4b UTSW 18 14813545 missense probably damaging 1.00
R7790:Taf4b UTSW 18 14813274 missense probably damaging 1.00
R8021:Taf4b UTSW 18 14804524 missense probably damaging 1.00
R8072:Taf4b UTSW 18 14821528 missense probably benign
R8075:Taf4b UTSW 18 14783692 missense possibly damaging 0.58
R8145:Taf4b UTSW 18 14830028 missense probably damaging 1.00
R8221:Taf4b UTSW 18 14898049 missense probably damaging 1.00
R8320:Taf4b UTSW 18 14783692 missense possibly damaging 0.58
R8509:Taf4b UTSW 18 14898055 missense probably damaging 1.00
R8535:Taf4b UTSW 18 14822138 missense probably damaging 0.99
R8772:Taf4b UTSW 18 14835852 missense probably damaging 1.00
R8805:Taf4b UTSW 18 14813428 missense possibly damaging 0.65
R8874:Taf4b UTSW 18 14830070 missense probably benign 0.39
R9155:Taf4b UTSW 18 14813239 missense probably benign 0.00
R9254:Taf4b UTSW 18 14813374 missense probably damaging 0.98
R9338:Taf4b UTSW 18 14821498 missense probably benign 0.00
R9379:Taf4b UTSW 18 14813374 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTCAAATGACGCACGTCTC -3'
(R):5'- TGTTGGTCTGAGATAAACAGGTC -3'

Sequencing Primer
(F):5'- TGACGCACGTCTCAAAGCTG -3'
(R):5'- TGGTCTGAGATAAACAGGTCATAAAC -3'
Posted On 2018-04-27