Incidental Mutation 'R6373:Mab21l1'
ID 513620
Institutional Source Beutler Lab
Gene Symbol Mab21l1
Ensembl Gene ENSMUSG00000056947
Gene Name mab-21-like 1 (C. elegans)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6373 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 55782510-55785001 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55783084 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 31 (I31F)
Ref Sequence ENSEMBL: ENSMUSP00000074878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029374] [ENSMUST00000075422]
AlphaFold O70299
Predicted Effect probably benign
Transcript: ENSMUST00000029374
SMART Domains Protein: ENSMUSP00000029374
Gene: ENSMUSG00000027799

DomainStartEndE-ValueType
low complexity region 19 40 N/A INTRINSIC
Pfam:Laminin_G_3 228 393 2.8e-13 PFAM
Pfam:DUF4704 462 733 4e-113 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 964 969 N/A INTRINSIC
low complexity region 1781 1790 N/A INTRINSIC
low complexity region 1791 1807 N/A INTRINSIC
low complexity region 1835 1845 N/A INTRINSIC
Pfam:DUF1088 1956 2122 3.5e-91 PFAM
Pfam:PH_BEACH 2148 2245 2.6e-32 PFAM
Beach 2276 2553 1.3e-205 SMART
WD40 2659 2696 2.12e2 SMART
WD40 2699 2742 2.22e0 SMART
WD40 2759 2798 9.21e0 SMART
WD40 2842 2880 2.88e-1 SMART
WD40 2883 2922 8.91e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000075422
AA Change: I31F

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074878
Gene: ENSMUSG00000056947
AA Change: I31F

DomainStartEndE-ValueType
Mab-21 61 347 3.59e-94 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199535
Meta Mutation Damage Score 0.3698 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to the MAB-21 cell fate-determining gene found in C. elegans. It may be involved in eye and cerebellum development, and it has been proposed that expansion of a trinucleotide repeat region in the 5' UTR may play a role in a variety of psychiatric disorders. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in male infertility and eye developmental anomalies. Mutant eyes are small, absent of lens and iris, and display malformations of the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,988,240 L279P probably damaging Het
Aldh16a1 C G 7: 45,146,271 V373L probably benign Het
Btn2a2 T C 13: 23,481,829 K278E probably benign Het
Carns1 G T 19: 4,166,516 Q556K probably benign Het
Chd1 A T 17: 15,738,636 E650V probably damaging Het
Cobl A G 11: 12,253,118 S1195P probably damaging Het
Ddx58 A G 4: 40,216,487 Y504H possibly damaging Het
Deup1 T C 9: 15,561,342 H464R probably damaging Het
Eva1a T C 6: 82,091,866 L58S probably damaging Het
Fign A C 2: 63,979,645 M427R probably benign Het
Gm6309 A T 5: 146,170,275 I87N probably damaging Het
Gm7879 A G 5: 43,913,551 T127A probably damaging Het
Helz A G 11: 107,595,184 T140A probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hist1h2ad A G 13: 23,574,853 K128R probably benign Het
Kif16b A T 2: 142,699,698 H1227Q possibly damaging Het
Mex3c T C 18: 73,589,994 M386T probably benign Het
Myh11 T A 16: 14,205,130 I1644F possibly damaging Het
Nav2 C T 7: 49,453,175 P513S probably damaging Het
Ncoa3 C T 2: 166,059,347 S953F possibly damaging Het
Nmt2 A G 2: 3,324,951 T462A probably benign Het
Nrxn2 T C 19: 6,509,830 I163T probably damaging Het
Nrxn3 G C 12: 89,976,469 G122R probably damaging Het
Olfr1165-ps T C 2: 88,101,845 I47M possibly damaging Het
Olfr385 A G 11: 73,588,898 V280A probably benign Het
Parg T G 14: 32,209,497 probably null Het
Pcdhb7 T A 18: 37,342,211 C133* probably null Het
Rpe T C 1: 66,715,980 F174L probably benign Het
Rxrb A G 17: 34,033,559 N40S probably benign Het
Ryr3 C A 2: 112,656,544 G3840W probably damaging Het
Smurf2 A G 11: 106,833,769 L529P probably damaging Het
Sntg2 C T 12: 30,258,041 R215H probably benign Het
Spata20 A G 11: 94,483,400 V348A probably benign Het
Spink5 A G 18: 43,990,672 E342G probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syce1l T A 8: 113,649,511 M31K probably benign Het
Ttn C T 2: 76,788,616 V14394I probably damaging Het
Twnk G A 19: 45,009,381 V450M probably damaging Het
Vangl1 T C 3: 102,158,448 K407R probably benign Het
Vmn1r19 T C 6: 57,405,332 I290T unknown Het
Other mutations in Mab21l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Mab21l1 APN 3 55783136 missense probably damaging 1.00
IGL01479:Mab21l1 APN 3 55783832 missense probably damaging 1.00
IGL02127:Mab21l1 APN 3 55783595 missense probably benign 0.01
IGL02707:Mab21l1 APN 3 55783084 missense possibly damaging 0.80
vermin UTSW 3 55783886 missense possibly damaging 0.95
R1529:Mab21l1 UTSW 3 55783833 nonsense probably null
R1911:Mab21l1 UTSW 3 55783627 missense possibly damaging 0.64
R5578:Mab21l1 UTSW 3 55784014 nonsense probably null
R5973:Mab21l1 UTSW 3 55783112 missense probably benign 0.32
R6008:Mab21l1 UTSW 3 55783097 missense possibly damaging 0.93
R7471:Mab21l1 UTSW 3 55783886 missense possibly damaging 0.95
R7779:Mab21l1 UTSW 3 55783375 missense possibly damaging 0.67
R7878:Mab21l1 UTSW 3 55784017 missense probably benign 0.18
R8122:Mab21l1 UTSW 3 55783484 missense probably benign 0.06
R8405:Mab21l1 UTSW 3 55783238 missense probably damaging 1.00
R8430:Mab21l1 UTSW 3 55783409 missense probably damaging 1.00
R8503:Mab21l1 UTSW 3 55783183 nonsense probably null
R8963:Mab21l1 UTSW 3 55782927 start gained probably benign
R9420:Mab21l1 UTSW 3 55783253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTCTCCACCGAAGTTGG -3'
(R):5'- TCAGTTTCAGCACCGCACAG -3'

Sequencing Primer
(F):5'- AAGTTGGCTCCAGCGCTAG -3'
(R):5'- TCGTCCACGAAGTTAAACACC -3'
Posted On 2018-04-27