Incidental Mutation 'R6373:Gm6309'
ID 513624
Institutional Source Beutler Lab
Gene Symbol Gm6309
Ensembl Gene ENSMUSG00000096798
Gene Name predicted gene 6309
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R6373 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 146167976-146170721 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 146170275 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 87 (I87N)
Ref Sequence ENSEMBL: ENSMUSP00000134203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174320]
AlphaFold L7N481
Predicted Effect probably damaging
Transcript: ENSMUST00000174320
AA Change: I87N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134203
Gene: ENSMUSG00000096798
AA Change: I87N

DomainStartEndE-ValueType
RasGEFN 65 181 3.29e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 95% (37/39)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,988,240 L279P probably damaging Het
Aldh16a1 C G 7: 45,146,271 V373L probably benign Het
Btn2a2 T C 13: 23,481,829 K278E probably benign Het
Carns1 G T 19: 4,166,516 Q556K probably benign Het
Chd1 A T 17: 15,738,636 E650V probably damaging Het
Cobl A G 11: 12,253,118 S1195P probably damaging Het
Ddx58 A G 4: 40,216,487 Y504H possibly damaging Het
Deup1 T C 9: 15,561,342 H464R probably damaging Het
Eva1a T C 6: 82,091,866 L58S probably damaging Het
Fign A C 2: 63,979,645 M427R probably benign Het
Gm7879 A G 5: 43,913,551 T127A probably damaging Het
Helz A G 11: 107,595,184 T140A probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hist1h2ad A G 13: 23,574,853 K128R probably benign Het
Kif16b A T 2: 142,699,698 H1227Q possibly damaging Het
Mab21l1 A T 3: 55,783,084 I31F possibly damaging Het
Mex3c T C 18: 73,589,994 M386T probably benign Het
Myh11 T A 16: 14,205,130 I1644F possibly damaging Het
Nav2 C T 7: 49,453,175 P513S probably damaging Het
Ncoa3 C T 2: 166,059,347 S953F possibly damaging Het
Nmt2 A G 2: 3,324,951 T462A probably benign Het
Nrxn2 T C 19: 6,509,830 I163T probably damaging Het
Nrxn3 G C 12: 89,976,469 G122R probably damaging Het
Olfr1165-ps T C 2: 88,101,845 I47M possibly damaging Het
Olfr385 A G 11: 73,588,898 V280A probably benign Het
Parg T G 14: 32,209,497 probably null Het
Pcdhb7 T A 18: 37,342,211 C133* probably null Het
Rpe T C 1: 66,715,980 F174L probably benign Het
Rxrb A G 17: 34,033,559 N40S probably benign Het
Ryr3 C A 2: 112,656,544 G3840W probably damaging Het
Smurf2 A G 11: 106,833,769 L529P probably damaging Het
Sntg2 C T 12: 30,258,041 R215H probably benign Het
Spata20 A G 11: 94,483,400 V348A probably benign Het
Spink5 A G 18: 43,990,672 E342G probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syce1l T A 8: 113,649,511 M31K probably benign Het
Ttn C T 2: 76,788,616 V14394I probably damaging Het
Twnk G A 19: 45,009,381 V450M probably damaging Het
Vangl1 T C 3: 102,158,448 K407R probably benign Het
Vmn1r19 T C 6: 57,405,332 I290T unknown Het
Other mutations in Gm6309
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Gm6309 APN 5 146168411 missense probably benign 0.02
IGL01835:Gm6309 APN 5 146168275 missense probably damaging 0.99
FR4737:Gm6309 UTSW 5 146168183 missense probably benign
FR4976:Gm6309 UTSW 5 146168183 missense probably benign
R1513:Gm6309 UTSW 5 146170583 missense possibly damaging 0.83
R2022:Gm6309 UTSW 5 146168311 missense probably benign
R2191:Gm6309 UTSW 5 146168871 missense possibly damaging 0.93
R4735:Gm6309 UTSW 5 146168244 missense probably damaging 0.99
R5719:Gm6309 UTSW 5 146168182 missense probably benign 0.01
R5776:Gm6309 UTSW 5 146168881 missense possibly damaging 0.80
R5833:Gm6309 UTSW 5 146168318 missense probably damaging 1.00
R6246:Gm6309 UTSW 5 146170240 missense probably damaging 1.00
R6873:Gm6309 UTSW 5 146168188 missense probably damaging 0.96
R6912:Gm6309 UTSW 5 146168830 missense probably damaging 0.97
R6954:Gm6309 UTSW 5 146168490 missense possibly damaging 0.82
R7145:Gm6309 UTSW 5 146170290 missense possibly damaging 0.74
R7258:Gm6309 UTSW 5 146168296 missense probably benign 0.07
R7535:Gm6309 UTSW 5 146168290 missense probably damaging 1.00
R8885:Gm6309 UTSW 5 146168293 missense probably damaging 1.00
R8941:Gm6309 UTSW 5 146170345 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCAGATTTAGACCCAAGACC -3'
(R):5'- TGTGAGACACTGAGGAGCATTC -3'

Sequencing Primer
(F):5'- GACCAACACTGCCAGGGTC -3'
(R):5'- ACACTGAGGAGCATTCTTGATG -3'
Posted On 2018-04-27