Incidental Mutation 'R6373:Aldh16a1'
ID513627
Institutional Source Beutler Lab
Gene Symbol Aldh16a1
Ensembl Gene ENSMUSG00000007833
Gene Namealdehyde dehydrogenase 16 family, member A1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6373 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45140684-45154584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 45146271 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 373 (V373L)
Ref Sequence ENSEMBL: ENSMUSP00000148069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107815] [ENSMUST00000209957] [ENSMUST00000209963] [ENSMUST00000210125] [ENSMUST00000211169] [ENSMUST00000211362]
Predicted Effect probably benign
Transcript: ENSMUST00000107815
AA Change: V373L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103445
Gene: ENSMUSG00000007833
AA Change: V373L

DomainStartEndE-ValueType
Pfam:Aldedh 48 488 3.8e-87 PFAM
Pfam:Aldedh 536 753 2.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209889
Predicted Effect probably benign
Transcript: ENSMUST00000209957
Predicted Effect probably benign
Transcript: ENSMUST00000209963
AA Change: V373L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000210125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210725
Predicted Effect probably benign
Transcript: ENSMUST00000211169
Predicted Effect probably benign
Transcript: ENSMUST00000211362
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldehyde dehydrogenase superfamily. The family members act on aldehyde substrates and use nicotinamide adenine dinucleotide phosphate (NADP) as a cofactor. This gene is conserved in chimpanzee, dog, cow, mouse, rat, and zebrafish. The protein encoded by this gene interacts with maspardin, a protein that when truncated is responsible for Mast syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,988,240 L279P probably damaging Het
Btn2a2 T C 13: 23,481,829 K278E probably benign Het
Carns1 G T 19: 4,166,516 Q556K probably benign Het
Chd1 A T 17: 15,738,636 E650V probably damaging Het
Cobl A G 11: 12,253,118 S1195P probably damaging Het
Ddx58 A G 4: 40,216,487 Y504H possibly damaging Het
Deup1 T C 9: 15,561,342 H464R probably damaging Het
Eva1a T C 6: 82,091,866 L58S probably damaging Het
Fign A C 2: 63,979,645 M427R probably benign Het
Gm6309 A T 5: 146,170,275 I87N probably damaging Het
Gm7879 A G 5: 43,913,551 T127A probably damaging Het
Helz A G 11: 107,595,184 T140A probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hist1h2ad A G 13: 23,574,853 K128R probably benign Het
Kif16b A T 2: 142,699,698 H1227Q possibly damaging Het
Mab21l1 A T 3: 55,783,084 I31F possibly damaging Het
Mex3c T C 18: 73,589,994 M386T probably benign Het
Myh11 T A 16: 14,205,130 I1644F possibly damaging Het
Nav2 C T 7: 49,453,175 P513S probably damaging Het
Ncoa3 C T 2: 166,059,347 S953F possibly damaging Het
Nmt2 A G 2: 3,324,951 T462A probably benign Het
Nrxn2 T C 19: 6,509,830 I163T probably damaging Het
Nrxn3 G C 12: 89,976,469 G122R probably damaging Het
Olfr1165-ps T C 2: 88,101,845 I47M possibly damaging Het
Olfr385 A G 11: 73,588,898 V280A probably benign Het
Parg T G 14: 32,209,497 probably null Het
Pcdhb7 T A 18: 37,342,211 C133* probably null Het
Rpe T C 1: 66,715,980 F174L probably benign Het
Rxrb A G 17: 34,033,559 N40S probably benign Het
Ryr3 C A 2: 112,656,544 G3840W probably damaging Het
Smurf2 A G 11: 106,833,769 L529P probably damaging Het
Sntg2 C T 12: 30,258,041 R215H probably benign Het
Spata20 A G 11: 94,483,400 V348A probably benign Het
Spink5 A G 18: 43,990,672 E342G probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syce1l T A 8: 113,649,511 M31K probably benign Het
Ttn C T 2: 76,788,616 V14394I probably damaging Het
Twnk G A 19: 45,009,381 V450M probably damaging Het
Vangl1 T C 3: 102,158,448 K407R probably benign Het
Vmn1r19 T C 6: 57,405,332 I290T unknown Het
Other mutations in Aldh16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Aldh16a1 APN 7 45145513 missense probably benign 0.00
IGL01449:Aldh16a1 APN 7 45141967 missense probably damaging 0.99
IGL01599:Aldh16a1 APN 7 45142093 missense probably damaging 0.99
IGL02118:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02120:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02123:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02125:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02126:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02794:Aldh16a1 APN 7 45145594 missense probably damaging 0.98
IGL03348:Aldh16a1 APN 7 45141975 missense possibly damaging 0.85
G1Funyon:Aldh16a1 UTSW 7 45141982 missense possibly damaging 0.80
R0242:Aldh16a1 UTSW 7 45144664 missense probably damaging 1.00
R0242:Aldh16a1 UTSW 7 45144664 missense probably damaging 1.00
R0305:Aldh16a1 UTSW 7 45147979 missense probably damaging 1.00
R0532:Aldh16a1 UTSW 7 45142838 missense probably damaging 1.00
R0550:Aldh16a1 UTSW 7 45146229 splice site probably null
R0707:Aldh16a1 UTSW 7 45144507 unclassified probably benign
R0801:Aldh16a1 UTSW 7 45147476 missense probably benign 0.00
R1224:Aldh16a1 UTSW 7 45142047 splice site probably null
R1371:Aldh16a1 UTSW 7 45147250 missense possibly damaging 0.78
R1778:Aldh16a1 UTSW 7 45147308 missense probably damaging 1.00
R2064:Aldh16a1 UTSW 7 45147161 critical splice donor site probably null
R4616:Aldh16a1 UTSW 7 45148788 intron probably benign
R4859:Aldh16a1 UTSW 7 45147307 missense probably benign 0.10
R4928:Aldh16a1 UTSW 7 45141961 missense probably damaging 1.00
R5476:Aldh16a1 UTSW 7 45142069 missense possibly damaging 0.89
R5591:Aldh16a1 UTSW 7 45144652 missense probably null 0.82
R5647:Aldh16a1 UTSW 7 45154465 missense probably benign 0.00
R5692:Aldh16a1 UTSW 7 45147799 missense probably damaging 1.00
R5698:Aldh16a1 UTSW 7 45154407 unclassified probably benign
R5879:Aldh16a1 UTSW 7 45147506 nonsense probably null
R5890:Aldh16a1 UTSW 7 45144545 missense probably benign 0.00
R6321:Aldh16a1 UTSW 7 45149765 missense probably damaging 1.00
R6338:Aldh16a1 UTSW 7 45141961 missense probably damaging 1.00
R6497:Aldh16a1 UTSW 7 45144937 missense possibly damaging 0.93
R6566:Aldh16a1 UTSW 7 45143227 missense probably benign 0.22
R7248:Aldh16a1 UTSW 7 45145594 missense probably damaging 0.98
R7303:Aldh16a1 UTSW 7 45147904 missense probably damaging 1.00
R7467:Aldh16a1 UTSW 7 45145907 missense probably benign 0.03
R7636:Aldh16a1 UTSW 7 45147531 missense unknown
R7830:Aldh16a1 UTSW 7 45146225 missense probably damaging 0.98
R8301:Aldh16a1 UTSW 7 45141982 missense possibly damaging 0.80
R8444:Aldh16a1 UTSW 7 45149691 missense probably benign 0.00
R8801:Aldh16a1 UTSW 7 45142014 missense probably benign
Z1177:Aldh16a1 UTSW 7 45145903 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCGTTAGTCGGAGAGCAAAC -3'
(R):5'- CTGGACTTAAGTGTCTAAGGGAGG -3'

Sequencing Primer
(F):5'- AGCAAACTCTCCTGTCAATACTTTAC -3'
(R):5'- TGTCTAAGGGAGGAGGGCTC -3'
Posted On2018-04-27