Incidental Mutation 'R6373:Olfr385'
ID513633
Institutional Source Beutler Lab
Gene Symbol Olfr385
Ensembl Gene ENSMUSG00000095095
Gene Nameolfactory receptor 385
SynonymsMOR135-3, GA_x6K02T2P1NL-3760313-3759375
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R6373 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73588302-73593008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73588898 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 280 (V280A)
Ref Sequence ENSEMBL: ENSMUSP00000149293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071553] [ENSMUST00000215689]
Predicted Effect probably benign
Transcript: ENSMUST00000071553
AA Change: V280A

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071484
Gene: ENSMUSG00000095095
AA Change: V280A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.1e-55 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.7e-6 PFAM
Pfam:7tm_1 41 290 2.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215689
AA Change: V280A

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0932 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,988,240 L279P probably damaging Het
Aldh16a1 C G 7: 45,146,271 V373L probably benign Het
Btn2a2 T C 13: 23,481,829 K278E probably benign Het
Carns1 G T 19: 4,166,516 Q556K probably benign Het
Chd1 A T 17: 15,738,636 E650V probably damaging Het
Cobl A G 11: 12,253,118 S1195P probably damaging Het
Ddx58 A G 4: 40,216,487 Y504H possibly damaging Het
Deup1 T C 9: 15,561,342 H464R probably damaging Het
Eva1a T C 6: 82,091,866 L58S probably damaging Het
Fign A C 2: 63,979,645 M427R probably benign Het
Gm6309 A T 5: 146,170,275 I87N probably damaging Het
Gm7879 A G 5: 43,913,551 T127A probably damaging Het
Helz A G 11: 107,595,184 T140A probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hist1h2ad A G 13: 23,574,853 K128R probably benign Het
Kif16b A T 2: 142,699,698 H1227Q possibly damaging Het
Mab21l1 A T 3: 55,783,084 I31F possibly damaging Het
Mex3c T C 18: 73,589,994 M386T probably benign Het
Myh11 T A 16: 14,205,130 I1644F possibly damaging Het
Nav2 C T 7: 49,453,175 P513S probably damaging Het
Ncoa3 C T 2: 166,059,347 S953F possibly damaging Het
Nmt2 A G 2: 3,324,951 T462A probably benign Het
Nrxn2 T C 19: 6,509,830 I163T probably damaging Het
Nrxn3 G C 12: 89,976,469 G122R probably damaging Het
Olfr1165-ps T C 2: 88,101,845 I47M possibly damaging Het
Parg T G 14: 32,209,497 probably null Het
Pcdhb7 T A 18: 37,342,211 C133* probably null Het
Rpe T C 1: 66,715,980 F174L probably benign Het
Rxrb A G 17: 34,033,559 N40S probably benign Het
Ryr3 C A 2: 112,656,544 G3840W probably damaging Het
Smurf2 A G 11: 106,833,769 L529P probably damaging Het
Sntg2 C T 12: 30,258,041 R215H probably benign Het
Spata20 A G 11: 94,483,400 V348A probably benign Het
Spink5 A G 18: 43,990,672 E342G probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syce1l T A 8: 113,649,511 M31K probably benign Het
Ttn C T 2: 76,788,616 V14394I probably damaging Het
Twnk G A 19: 45,009,381 V450M probably damaging Het
Vangl1 T C 3: 102,158,448 K407R probably benign Het
Vmn1r19 T C 6: 57,405,332 I290T unknown Het
Other mutations in Olfr385
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01570:Olfr385 APN 11 73589383 missense probably benign 0.34
IGL02045:Olfr385 APN 11 73589232 missense probably damaging 1.00
IGL02324:Olfr385 APN 11 73589255 missense probably benign 0.02
IGL02328:Olfr385 APN 11 73589255 missense probably benign 0.02
IGL02562:Olfr385 APN 11 73589411 missense probably benign
IGL02715:Olfr385 APN 11 73589121 missense probably benign 0.00
IGL03182:Olfr385 APN 11 73589442 missense probably benign 0.04
IGL03048:Olfr385 UTSW 11 73589005 missense possibly damaging 0.56
R0346:Olfr385 UTSW 11 73589457 missense probably damaging 1.00
R0675:Olfr385 UTSW 11 73589252 missense probably damaging 1.00
R0751:Olfr385 UTSW 11 73589144 missense probably benign 0.02
R1220:Olfr385 UTSW 11 73589377 nonsense probably null
R1389:Olfr385 UTSW 11 73589543 missense possibly damaging 0.88
R1484:Olfr385 UTSW 11 73589361 missense possibly damaging 0.91
R1619:Olfr385 UTSW 11 73589292 missense probably damaging 1.00
R2290:Olfr385 UTSW 11 73588919 missense probably benign 0.37
R3713:Olfr385 UTSW 11 73588905 missense probably damaging 1.00
R3781:Olfr385 UTSW 11 73589013 missense probably damaging 1.00
R3781:Olfr385 UTSW 11 73589368 nonsense probably null
R3782:Olfr385 UTSW 11 73589013 missense probably damaging 1.00
R3782:Olfr385 UTSW 11 73589368 nonsense probably null
R4402:Olfr385 UTSW 11 73589255 missense probably benign 0.02
R4721:Olfr385 UTSW 11 73589447 missense probably damaging 1.00
R5157:Olfr385 UTSW 11 73589723 missense probably damaging 1.00
R5995:Olfr385 UTSW 11 73589250 missense probably benign
R6658:Olfr385 UTSW 11 73589048 missense probably damaging 0.99
R7046:Olfr385 UTSW 11 73589732 missense probably benign
R7096:Olfr385 UTSW 11 73589637 missense probably benign 0.03
R7238:Olfr385 UTSW 11 73589735 start codon destroyed probably null 0.99
R7537:Olfr385 UTSW 11 73589268 missense probably benign 0.04
R7548:Olfr385 UTSW 11 73588976 missense possibly damaging 0.56
R7888:Olfr385 UTSW 11 73589528 missense probably damaging 0.99
R7971:Olfr385 UTSW 11 73589528 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACACTTTGGTAGATGCAAACATG -3'
(R):5'- GTCCTATGTACAAATTGTCTGCTC -3'

Sequencing Primer
(F):5'- GTCTAAATGCAAGTATTGCC -3'
(R):5'- CCATTCTAAAGTTTTCATCTACACGG -3'
Posted On2018-04-27