Mutagenetix > Incidental Mutation

Incidental Mutation 'R6373:Spink5'

513647

Institutional Source

Beutler Lab

Gene Symbol

Spink5

Ensembl Gene

ENSMUSG00000055561

Gene Name

serine peptidase inhibitor, Kazal type 5

Synonyms

2310065D10Rik, LEKT1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6373 (G1)

Quality Score

207.009

Status

Validated

Chromosome

Chromosomal Location

43963235-44022501 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43990672 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 342 (E342G)

Ref Sequence

ENSEMBL: ENSMUSP00000066214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069245]

AlphaFold

Q148R4

Predicted Effect

probably damaging
Transcript: ENSMUST00000069245
AA Change: E342G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: E342G

Domain	Start	End	E-Value	Type
PDB:1UUC\|A	26	77	3e-6	PDB
KAZAL	97	152	1.67e-15	SMART
KAZAL	161	216	2.07e-3	SMART
KAZAL	226	281	3.37e-11	SMART
KAZAL	298	353	2.92e-6	SMART
KAZAL	367	424	6.73e-3	SMART
KAZAL	426	480	6.07e-4	SMART
KAZAL	496	558	2.43e-1	SMART
KAZAL	559	614	2.72e-15	SMART
KAZAL	633	687	1.95e-7	SMART
KAZAL	700	755	1.01e-9	SMART
KAZAL	769	824	7.29e-7	SMART
KAZAL	865	931	1.32e-4	SMART
KAZAL	942	996	2.74e-11	SMART

Meta Mutation Damage Score

0.5367

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

95% (37/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd13	T	C	8: 9,988,240	L279P	probably damaging	Het
Aldh16a1	C	G	7: 45,146,271	V373L	probably benign	Het
Btn2a2	T	C	13: 23,481,829	K278E	probably benign	Het
Carns1	G	T	19: 4,166,516	Q556K	probably benign	Het
Chd1	A	T	17: 15,738,636	E650V	probably damaging	Het
Cobl	A	G	11: 12,253,118	S1195P	probably damaging	Het
Ddx58	A	G	4: 40,216,487	Y504H	possibly damaging	Het
Deup1	T	C	9: 15,561,342	H464R	probably damaging	Het
Eva1a	T	C	6: 82,091,866	L58S	probably damaging	Het
Fign	A	C	2: 63,979,645	M427R	probably benign	Het
Gm6309	A	T	5: 146,170,275	I87N	probably damaging	Het
Gm7879	A	G	5: 43,913,551	T127A	probably damaging	Het
Helz	A	G	11: 107,595,184	T140A	probably benign	Het
Helz2	C	T	2: 181,233,467	E1745K	probably damaging	Het
Hist1h2ad	A	G	13: 23,574,853	K128R	probably benign	Het
Kif16b	A	T	2: 142,699,698	H1227Q	possibly damaging	Het
Mab21l1	A	T	3: 55,783,084	I31F	possibly damaging	Het
Mex3c	T	C	18: 73,589,994	M386T	probably benign	Het
Myh11	T	A	16: 14,205,130	I1644F	possibly damaging	Het
Nav2	C	T	7: 49,453,175	P513S	probably damaging	Het
Ncoa3	C	T	2: 166,059,347	S953F	possibly damaging	Het
Nmt2	A	G	2: 3,324,951	T462A	probably benign	Het
Nrxn2	T	C	19: 6,509,830	I163T	probably damaging	Het
Nrxn3	G	C	12: 89,976,469	G122R	probably damaging	Het
Olfr1165-ps	T	C	2: 88,101,845	I47M	possibly damaging	Het
Olfr385	A	G	11: 73,588,898	V280A	probably benign	Het
Parg	T	G	14: 32,209,497		probably null	Het
Pcdhb7	T	A	18: 37,342,211	C133*	probably null	Het
Rpe	T	C	1: 66,715,980	F174L	probably benign	Het
Rxrb	A	G	17: 34,033,559	N40S	probably benign	Het
Ryr3	C	A	2: 112,656,544	G3840W	probably damaging	Het
Smurf2	A	G	11: 106,833,769	L529P	probably damaging	Het
Sntg2	C	T	12: 30,258,041	R215H	probably benign	Het
Spata20	A	G	11: 94,483,400	V348A	probably benign	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Syce1l	T	A	8: 113,649,511	M31K	probably benign	Het
Ttn	C	T	2: 76,788,616	V14394I	probably damaging	Het
Twnk	G	A	19: 45,009,381	V450M	probably damaging	Het
Vangl1	T	C	3: 102,158,448	K407R	probably benign	Het
Vmn1r19	T	C	6: 57,405,332	I290T	unknown	Het

Other mutations in Spink5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Spink5	APN	18	43987871	splice site	probably benign
IGL00332:Spink5	APN	18	43967044	missense	probably benign	0.00
IGL00501:Spink5	APN	18	43977739	missense	probably damaging	0.98
IGL00772:Spink5	APN	18	44006420	missense	probably benign	0.02
IGL00920:Spink5	APN	18	44003209	missense	probably damaging	1.00
IGL00980:Spink5	APN	18	44007710	missense	probably damaging	1.00
IGL01016:Spink5	APN	18	44007644	missense	probably damaging	1.00
IGL01155:Spink5	APN	18	43981147	missense	probably benign	0.01
IGL01374:Spink5	APN	18	43989404	missense	possibly damaging	0.74
IGL01629:Spink5	APN	18	43996610	splice site	probably benign
IGL01907:Spink5	APN	18	43996676	missense	probably damaging	1.00
IGL01931:Spink5	APN	18	44015638	missense	probably benign	0.02
IGL02237:Spink5	APN	18	44012867	missense	probably benign	0.03
IGL02306:Spink5	APN	18	43964444	missense	probably damaging	0.98
IGL02402:Spink5	APN	18	43967104	missense	probably damaging	1.00
IGL02425:Spink5	APN	18	43990744	critical splice donor site	probably null
IGL02552:Spink5	APN	18	43992168	missense	possibly damaging	0.80
IGL02554:Spink5	APN	18	44015594	missense	probably benign	0.01
IGL03066:Spink5	APN	18	44016390	missense	probably damaging	1.00
IGL03288:Spink5	APN	18	44014760	missense	possibly damaging	0.59
crusty2	UTSW	18	43999935	splice site	probably benign
R0079:Spink5	UTSW	18	43977764	missense	probably damaging	1.00
R0184:Spink5	UTSW	18	44003198	missense	probably benign	0.00
R0452:Spink5	UTSW	18	43963318	missense	possibly damaging	0.74
R0569:Spink5	UTSW	18	43989419	missense	probably damaging	1.00
R0639:Spink5	UTSW	18	44012975	splice site	probably null
R0648:Spink5	UTSW	18	43999797	splice site	probably benign
R0705:Spink5	UTSW	18	43992274	missense	probably benign	0.01
R1170:Spink5	UTSW	18	43983563	missense	probably benign	0.07
R1290:Spink5	UTSW	18	44007711	missense	probably damaging	0.99
R1345:Spink5	UTSW	18	43990682	missense	possibly damaging	0.88
R1458:Spink5	UTSW	18	44007719	missense	probably benign	0.01
R1530:Spink5	UTSW	18	44015671	missense	probably damaging	0.96
R1570:Spink5	UTSW	18	43967107	missense	probably benign	0.00
R1820:Spink5	UTSW	18	43989419	missense	possibly damaging	0.94
R1843:Spink5	UTSW	18	43999891	missense	probably benign	0.03
R1968:Spink5	UTSW	18	43990708	missense	probably benign	0.06
R2050:Spink5	UTSW	18	44007758	critical splice donor site	probably null
R2252:Spink5	UTSW	18	44020824	nonsense	probably null
R2278:Spink5	UTSW	18	43986329	missense	probably benign	0.07
R2279:Spink5	UTSW	18	43986329	missense	probably benign	0.07
R2696:Spink5	UTSW	18	43982292	missense	probably damaging	1.00
R2992:Spink5	UTSW	18	43996629	missense	probably damaging	1.00
R3422:Spink5	UTSW	18	44010244	missense	probably benign	0.01
R3934:Spink5	UTSW	18	44016427	missense	probably damaging	1.00
R4179:Spink5	UTSW	18	43987867	missense	probably benign
R4854:Spink5	UTSW	18	44020841	makesense	probably null
R5011:Spink5	UTSW	18	44006412	missense	probably damaging	0.97
R5133:Spink5	UTSW	18	43986423	missense	probably damaging	1.00
R5163:Spink5	UTSW	18	43999857	missense	possibly damaging	0.95
R5185:Spink5	UTSW	18	44015644	missense	probably damaging	0.97
R5187:Spink5	UTSW	18	43989451	missense	probably damaging	1.00
R5292:Spink5	UTSW	18	44006454	missense	probably benign
R5332:Spink5	UTSW	18	43992917	missense	possibly damaging	0.89
R5600:Spink5	UTSW	18	44018711	missense	probably damaging	0.96
R6267:Spink5	UTSW	18	44014757	missense	probably damaging	0.99
R6296:Spink5	UTSW	18	44014757	missense	probably damaging	0.99
R6982:Spink5	UTSW	18	43977725	missense	probably damaging	1.00
R6982:Spink5	UTSW	18	44010042	splice site	probably null
R7332:Spink5	UTSW	18	43982250	missense	probably damaging	0.96
R7396:Spink5	UTSW	18	43977655	missense	possibly damaging	0.95
R7643:Spink5	UTSW	18	44010252	missense	probably benign	0.37
R7726:Spink5	UTSW	18	43963352	missense	probably damaging	1.00
R7828:Spink5	UTSW	18	44010229	missense	probably benign	0.15
R7836:Spink5	UTSW	18	43999821	missense	probably benign	0.00
R7880:Spink5	UTSW	18	43986326	missense	probably benign	0.40
R8031:Spink5	UTSW	18	44010236	missense	probably benign	0.07
R8198:Spink5	UTSW	18	43992880	missense	probably benign	0.17
R8361:Spink5	UTSW	18	43989462	missense	probably damaging	1.00
R8375:Spink5	UTSW	18	43990719	missense	probably benign	0.01
R8684:Spink5	UTSW	18	44010238	missense	probably benign	0.02
R8749:Spink5	UTSW	18	43989358	nonsense	probably null
R8918:Spink5	UTSW	18	43967020	missense	probably damaging	0.98
R9064:Spink5	UTSW	18	43967126	missense	probably damaging	1.00
R9161:Spink5	UTSW	18	44014919	missense	probably damaging	1.00
R9221:Spink5	UTSW	18	43986300	missense	probably damaging	1.00
R9292:Spink5	UTSW	18	44015008	missense	possibly damaging	0.91
R9545:Spink5	UTSW	18	44003195	missense	possibly damaging	0.88
Z1177:Spink5	UTSW	18	43996635	missense	probably damaging	0.97
Z1177:Spink5	UTSW	18	43996697	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTCATAGGATGTCAGCTTATTGG -3'
(R):5'- GTCTCTTAACAGGAAGAATGAATCCG -3'

Sequencing Primer
(F):5'- ATAGGATGTCAGCTTATTGGAAGTAG -3'
(R):5'- TGAATCCGTTTCATACAATGCTC -3'

Posted On

2018-04-27