Incidental Mutation 'R6374:Trim66'
ID513690
Institutional Source Beutler Lab
Gene Symbol Trim66
Ensembl Gene ENSMUSG00000031026
Gene Nametripartite motif-containing 66
SynonymsTif1d, D7H11orf29
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R6374 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location109449006-109508134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 109486062 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 100 (K100N)
Ref Sequence ENSEMBL: ENSMUSP00000102352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033339] [ENSMUST00000106739] [ENSMUST00000106741]
Predicted Effect probably benign
Transcript: ENSMUST00000033339
SMART Domains Protein: ENSMUSP00000033339
Gene: ENSMUSG00000031026

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106739
SMART Domains Protein: ENSMUSP00000102350
Gene: ENSMUSG00000031026

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106741
AA Change: K100N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102352
Gene: ENSMUSG00000031026
AA Change: K100N

DomainStartEndE-ValueType
RING 28 78 2.38e-2 SMART
BBOX 102 140 1.48e0 SMART
PHD 106 171 7.77e0 SMART
RING 107 170 4.38e0 SMART
BBOX 162 203 4.21e-3 SMART
BBC 210 336 1.61e-39 SMART
low complexity region 420 435 N/A INTRINSIC
low complexity region 554 588 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
PHD 1100 1143 4.09e-10 SMART
BROMO 1171 1277 8.22e-27 SMART
low complexity region 1287 1301 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,880 S293A possibly damaging Het
4932415D10Rik T A 10: 82,288,897 probably benign Het
5430401F13Rik A T 6: 131,552,929 Q162L unknown Het
Abca8a A T 11: 110,083,390 Y239* probably null Het
Aox3 T C 1: 58,172,161 I959T probably benign Het
Atad2b T C 12: 5,018,002 V1000A probably damaging Het
Atic C T 1: 71,564,941 T221M probably damaging Het
Atp1a2 C T 1: 172,289,375 R225H probably damaging Het
BC024139 A G 15: 76,120,457 probably null Het
Bpi A T 2: 158,272,054 T291S probably damaging Het
Ccdc170 C T 10: 4,549,746 Q556* probably null Het
Cd3e G A 9: 45,009,363 L12F probably benign Het
Cdc42ep1 A T 15: 78,847,449 R31S probably damaging Het
Cyp21a1 G T 17: 34,804,136 probably null Het
Dnase1l3 A G 14: 7,974,115 M192T probably damaging Het
Dnmt1 A T 9: 20,924,045 H330Q possibly damaging Het
Enah T C 1: 181,923,580 E232G unknown Het
Etnppl C T 3: 130,620,693 T73I probably damaging Het
Fam83b T A 9: 76,492,907 I305F probably benign Het
Galnt15 T A 14: 32,058,159 I471N probably damaging Het
Gm19965 T A 1: 116,822,291 N567K probably benign Het
Golga1 T C 2: 39,034,068 Q435R probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Hao1 T G 2: 134,523,104 D201A probably benign Het
Heg1 T C 16: 33,727,129 L786P possibly damaging Het
Hnrnpll A T 17: 80,049,874 C238S possibly damaging Het
Hrg A G 16: 22,960,992 Y340C probably damaging Het
Kyat3 A T 3: 142,738,237 I411F probably damaging Het
Myo1a T C 10: 127,707,680 Y202H probably damaging Het
Nags T C 11: 102,146,511 C143R possibly damaging Het
Ncoa6 T C 2: 155,421,156 N453D probably damaging Het
Nup35 G T 2: 80,658,386 M322I probably benign Het
Olfr620 A G 7: 103,611,921 L144P probably benign Het
Oprl1 T C 2: 181,715,928 V69A probably damaging Het
Pappa2 T A 1: 158,956,645 Y265F probably damaging Het
Pcsk6 C T 7: 65,980,155 P343L possibly damaging Het
Peak1 C A 9: 56,257,666 D993Y probably damaging Het
Polr2a T C 11: 69,736,932 Y1383C probably damaging Het
Ppme1 A G 7: 100,341,065 S226P probably damaging Het
Prom1 C T 5: 44,055,983 C127Y probably damaging Het
Ptpn6 A T 6: 124,732,569 probably null Het
Reln T C 5: 22,080,714 E419G probably benign Het
Rnf32 C T 5: 29,225,268 Q362* probably null Het
Sbspon T C 1: 15,883,663 D131G probably benign Het
Scyl3 T C 1: 163,949,214 S392P probably benign Het
Shtn1 T A 19: 59,038,296 D121V possibly damaging Het
Sin3a A G 9: 57,117,481 T1042A probably benign Het
Sipa1l2 A T 8: 125,444,630 V1371D probably damaging Het
Slc20a2 T C 8: 22,565,652 V584A possibly damaging Het
Smc6 T A 12: 11,305,873 probably null Het
Specc1 C T 11: 62,156,592 T849I possibly damaging Het
Spta1 T A 1: 174,214,168 L1368H probably damaging Het
Sqle A G 15: 59,316,110 E89G possibly damaging Het
Strbp A G 2: 37,603,008 V422A probably damaging Het
Sult6b1 G T 17: 78,906,931 T21K probably benign Het
Tex15 A G 8: 33,575,912 E1790G probably damaging Het
Tmem88b T A 4: 155,785,764 probably benign Het
Traf3ip3 T C 1: 193,182,010 D355G possibly damaging Het
Trim24 T A 6: 37,953,549 V576E probably benign Het
Trim30c C T 7: 104,390,402 G62D probably benign Het
Tsnaxip1 A T 8: 105,841,540 T313S possibly damaging Het
Ugt2b37 A T 5: 87,242,420 I389N probably damaging Het
Unc13a C T 8: 71,641,453 V1335M possibly damaging Het
Urah A G 7: 140,835,211 T5A probably benign Het
Usp34 T C 11: 23,438,914 Y2185H probably damaging Het
Usp44 T C 10: 93,856,310 S643P probably benign Het
Vars2 A G 17: 35,660,045 V631A probably damaging Het
Vmn2r11 G A 5: 109,053,813 T275I possibly damaging Het
Vmn2r54 C A 7: 12,615,493 V721F probably damaging Het
Vmn2r79 T C 7: 87,002,290 I299T probably benign Het
Vps13d T C 4: 145,122,681 T2387A probably damaging Het
Washc5 A T 15: 59,337,195 L610Q probably benign Het
Zbtb21 T C 16: 97,950,368 E905G probably damaging Het
Zfhx4 A G 3: 5,244,035 T774A probably damaging Het
Zfp534 T C 4: 147,674,842 I457V probably benign Het
Zfp964 T C 8: 69,659,344 Y29H possibly damaging Het
Znrf4 A G 17: 56,511,702 F202L probably damaging Het
Other mutations in Trim66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Trim66 APN 7 109455066 missense probably benign 0.02
IGL01758:Trim66 APN 7 109486045 critical splice donor site probably null
IGL01982:Trim66 APN 7 109458763 missense probably benign 0.00
IGL01983:Trim66 APN 7 109458251 nonsense probably null
IGL02149:Trim66 APN 7 109460902 missense possibly damaging 0.66
IGL02392:Trim66 APN 7 109460274 missense probably benign 0.01
IGL02483:Trim66 APN 7 109477630 splice site probably benign
IGL02832:Trim66 APN 7 109460497 missense probably damaging 1.00
IGL02945:Trim66 APN 7 109460176 nonsense probably null
IGL03085:Trim66 APN 7 109458745 missense probably benign 0.17
PIT1430001:Trim66 UTSW 7 109475247 missense probably damaging 0.99
R0326:Trim66 UTSW 7 109460172 missense probably benign 0.00
R0358:Trim66 UTSW 7 109460176 nonsense probably null
R0401:Trim66 UTSW 7 109475264 missense probably damaging 0.98
R0470:Trim66 UTSW 7 109457542 splice site probably benign
R0568:Trim66 UTSW 7 109460695 missense probably benign 0.00
R0669:Trim66 UTSW 7 109454992 intron probably benign
R0980:Trim66 UTSW 7 109455670 missense probably damaging 1.00
R1015:Trim66 UTSW 7 109455233 missense probably damaging 1.00
R1078:Trim66 UTSW 7 109472319 missense probably damaging 1.00
R1099:Trim66 UTSW 7 109475454 missense probably benign 0.34
R1181:Trim66 UTSW 7 109484577 critical splice donor site probably null
R1497:Trim66 UTSW 7 109484619 missense probably benign 0.00
R1583:Trim66 UTSW 7 109455080 missense probably damaging 1.00
R1843:Trim66 UTSW 7 109475839 missense probably damaging 0.99
R1998:Trim66 UTSW 7 109484577 critical splice donor site probably null
R2016:Trim66 UTSW 7 109472232 critical splice donor site probably null
R2143:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R2144:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R2145:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R3945:Trim66 UTSW 7 109472268 missense possibly damaging 0.94
R4012:Trim66 UTSW 7 109458131 missense probably damaging 0.98
R4464:Trim66 UTSW 7 109477690 missense possibly damaging 0.51
R4473:Trim66 UTSW 7 109481995 missense probably damaging 1.00
R4729:Trim66 UTSW 7 109456060 critical splice donor site probably null
R4730:Trim66 UTSW 7 109483069 missense probably damaging 1.00
R4775:Trim66 UTSW 7 109457589 nonsense probably null
R4819:Trim66 UTSW 7 109457586 missense probably damaging 1.00
R5269:Trim66 UTSW 7 109457590 missense probably benign 0.00
R5557:Trim66 UTSW 7 109483737 missense probably benign 0.06
R5832:Trim66 UTSW 7 109455202 missense probably damaging 1.00
R6220:Trim66 UTSW 7 109483093 missense probably damaging 0.97
R6243:Trim66 UTSW 7 109460274 missense probably benign 0.01
R6450:Trim66 UTSW 7 109460738 missense probably benign 0.09
R6543:Trim66 UTSW 7 109475879 missense probably benign 0.01
R6788:Trim66 UTSW 7 109477754 missense probably damaging 1.00
R6842:Trim66 UTSW 7 109460776 missense probably benign 0.00
R7169:Trim66 UTSW 7 109455121 missense probably benign 0.25
R7257:Trim66 UTSW 7 109460244 missense probably damaging 1.00
R7328:Trim66 UTSW 7 109457751 missense probably damaging 0.99
R7616:Trim66 UTSW 7 109483749 missense probably damaging 0.99
RF013:Trim66 UTSW 7 109460753 missense probably damaging 0.99
RF024:Trim66 UTSW 7 109460740 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCCACTCAAAGCATGTAATTTCACC -3'
(R):5'- TGCTGGGTATTAGAAAGTCCCC -3'

Sequencing Primer
(F):5'- CAAAGCATGTAATTTCACCTAGGAG -3'
(R):5'- GGTATTAGAAAGTCCCCTTCTAGGC -3'
Posted On2018-04-27