Incidental Mutation 'R6374:Dnmt1'
ID513698
Institutional Source Beutler Lab
Gene Symbol Dnmt1
Ensembl Gene ENSMUSG00000004099
Gene NameDNA methyltransferase (cytosine-5) 1
SynonymsMTase, Dnmt1o, Cxxc9, MommeD2
MMRRC Submission
Accession Numbers

Genbank: NM_010066

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6374 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location20907209-20959888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20924045 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 330 (H330Q)
Ref Sequence ENSEMBL: ENSMUSP00000136669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004202] [ENSMUST00000177754] [ENSMUST00000178110] [ENSMUST00000216540]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004202
AA Change: H449Q

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000004202
Gene: ENSMUSG00000004099
AA Change: H449Q

DomainStartEndE-ValueType
DMAP_binding 16 106 1.7e-13 SMART
low complexity region 121 143 N/A INTRINSIC
low complexity region 156 166 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
low complexity region 306 328 N/A INTRINSIC
Pfam:DNMT1-RFD 405 540 4.8e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Pfam:zf-CXXC 648 694 2.7e-17 PFAM
low complexity region 701 711 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
BAH 758 884 4.62e-31 SMART
BAH 935 1103 1.79e-37 SMART
low complexity region 1110 1124 N/A INTRINSIC
Pfam:DNA_methylase 1142 1596 1.3e-49 PFAM
low complexity region 1600 1619 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177754
AA Change: H330Q

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136982
Gene: ENSMUSG00000004099
AA Change: H330Q

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 154 171 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
Pfam:DNMT1-RFD 286 421 3.4e-40 PFAM
low complexity region 491 506 N/A INTRINSIC
Pfam:zf-CXXC 529 575 2.3e-17 PFAM
low complexity region 582 592 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
BAH 639 765 4.62e-31 SMART
BAH 816 984 1.79e-37 SMART
low complexity region 991 1005 N/A INTRINSIC
Pfam:DNA_methylase 1023 1477 1.3e-49 PFAM
low complexity region 1481 1500 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178110
AA Change: H330Q

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136669
Gene: ENSMUSG00000004099
AA Change: H330Q

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
low complexity region 38 48 N/A INTRINSIC
low complexity region 62 76 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
Pfam:DNMT1-RFD 287 422 2.6e-40 PFAM
low complexity region 492 507 N/A INTRINSIC
Pfam:zf-CXXC 530 576 4.7e-17 PFAM
low complexity region 583 593 N/A INTRINSIC
low complexity region 601 613 N/A INTRINSIC
BAH 640 766 4.62e-31 SMART
BAH 817 985 1.79e-37 SMART
low complexity region 992 1006 N/A INTRINSIC
Pfam:DNA_methylase 1024 1478 8e-50 PFAM
low complexity region 1482 1501 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000216540
AA Change: H331Q

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: This gene encodes a methyltransferase that preferentially methylates cytosines of CpG residues in hemimethylated DNA to generate fully methylated CpG base pairs during DNA replication. This enzyme plays roles in diverse cellular processes including cell cycle regulation, DNA repair, and telomere maintenance. The encoded protein is composed of an N-terminal domain with a nuclear localization sequence and replication fork-targeting domain, a DNA-binding CXXC domain, two bromo-adjacent homology domains, and a C-terminal catalytic domain. Mouse embryonic stem cells mutant for this gene are viable, but when introduced into the germ line, cause a recessive lethal phenotype with mutant embryos displaying stunted growth and developmental defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations causing partial or severe loss of function were homozygous lethal by embryonic day 9.5, with lack of appropriate genomic imprinting observed at several loci. [provided by MGI curators]
Allele List at MGI

All alleles(109) : Targeted, knock-out(5) Targeted, other(11) Gene trapped(92) Chemically induced(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,880 S293A possibly damaging Het
4932415D10Rik T A 10: 82,288,897 probably benign Het
5430401F13Rik A T 6: 131,552,929 Q162L unknown Het
Abca8a A T 11: 110,083,390 Y239* probably null Het
Aox3 T C 1: 58,172,161 I959T probably benign Het
Atad2b T C 12: 5,018,002 V1000A probably damaging Het
Atic C T 1: 71,564,941 T221M probably damaging Het
Atp1a2 C T 1: 172,289,375 R225H probably damaging Het
BC024139 A G 15: 76,120,457 probably null Het
Bpi A T 2: 158,272,054 T291S probably damaging Het
Ccdc170 C T 10: 4,549,746 Q556* probably null Het
Cd3e G A 9: 45,009,363 L12F probably benign Het
Cdc42ep1 A T 15: 78,847,449 R31S probably damaging Het
Cyp21a1 G T 17: 34,804,136 probably null Het
Dnase1l3 A G 14: 7,974,115 M192T probably damaging Het
Enah T C 1: 181,923,580 E232G unknown Het
Etnppl C T 3: 130,620,693 T73I probably damaging Het
Fam83b T A 9: 76,492,907 I305F probably benign Het
Galnt15 T A 14: 32,058,159 I471N probably damaging Het
Gm19965 T A 1: 116,822,291 N567K probably benign Het
Golga1 T C 2: 39,034,068 Q435R probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Hao1 T G 2: 134,523,104 D201A probably benign Het
Heg1 T C 16: 33,727,129 L786P possibly damaging Het
Hnrnpll A T 17: 80,049,874 C238S possibly damaging Het
Hrg A G 16: 22,960,992 Y340C probably damaging Het
Kyat3 A T 3: 142,738,237 I411F probably damaging Het
Myo1a T C 10: 127,707,680 Y202H probably damaging Het
Nags T C 11: 102,146,511 C143R possibly damaging Het
Ncoa6 T C 2: 155,421,156 N453D probably damaging Het
Nup35 G T 2: 80,658,386 M322I probably benign Het
Olfr620 A G 7: 103,611,921 L144P probably benign Het
Oprl1 T C 2: 181,715,928 V69A probably damaging Het
Pappa2 T A 1: 158,956,645 Y265F probably damaging Het
Pcsk6 C T 7: 65,980,155 P343L possibly damaging Het
Peak1 C A 9: 56,257,666 D993Y probably damaging Het
Polr2a T C 11: 69,736,932 Y1383C probably damaging Het
Ppme1 A G 7: 100,341,065 S226P probably damaging Het
Prom1 C T 5: 44,055,983 C127Y probably damaging Het
Ptpn6 A T 6: 124,732,569 probably null Het
Reln T C 5: 22,080,714 E419G probably benign Het
Rnf32 C T 5: 29,225,268 Q362* probably null Het
Sbspon T C 1: 15,883,663 D131G probably benign Het
Scyl3 T C 1: 163,949,214 S392P probably benign Het
Shtn1 T A 19: 59,038,296 D121V possibly damaging Het
Sin3a A G 9: 57,117,481 T1042A probably benign Het
Sipa1l2 A T 8: 125,444,630 V1371D probably damaging Het
Slc20a2 T C 8: 22,565,652 V584A possibly damaging Het
Smc6 T A 12: 11,305,873 probably null Het
Specc1 C T 11: 62,156,592 T849I possibly damaging Het
Spta1 T A 1: 174,214,168 L1368H probably damaging Het
Sqle A G 15: 59,316,110 E89G possibly damaging Het
Strbp A G 2: 37,603,008 V422A probably damaging Het
Sult6b1 G T 17: 78,906,931 T21K probably benign Het
Tex15 A G 8: 33,575,912 E1790G probably damaging Het
Tmem88b T A 4: 155,785,764 probably benign Het
Traf3ip3 T C 1: 193,182,010 D355G possibly damaging Het
Trim24 T A 6: 37,953,549 V576E probably benign Het
Trim30c C T 7: 104,390,402 G62D probably benign Het
Trim66 T G 7: 109,486,062 K100N probably benign Het
Tsnaxip1 A T 8: 105,841,540 T313S possibly damaging Het
Ugt2b37 A T 5: 87,242,420 I389N probably damaging Het
Unc13a C T 8: 71,641,453 V1335M possibly damaging Het
Urah A G 7: 140,835,211 T5A probably benign Het
Usp34 T C 11: 23,438,914 Y2185H probably damaging Het
Usp44 T C 10: 93,856,310 S643P probably benign Het
Vars2 A G 17: 35,660,045 V631A probably damaging Het
Vmn2r11 G A 5: 109,053,813 T275I possibly damaging Het
Vmn2r54 C A 7: 12,615,493 V721F probably damaging Het
Vmn2r79 T C 7: 87,002,290 I299T probably benign Het
Vps13d T C 4: 145,122,681 T2387A probably damaging Het
Washc5 A T 15: 59,337,195 L610Q probably benign Het
Zbtb21 T C 16: 97,950,368 E905G probably damaging Het
Zfhx4 A G 3: 5,244,035 T774A probably damaging Het
Zfp534 T C 4: 147,674,842 I457V probably benign Het
Zfp964 T C 8: 69,659,344 Y29H possibly damaging Het
Znrf4 A G 17: 56,511,702 F202L probably damaging Het
Other mutations in Dnmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dnmt1 APN 9 20910270 missense possibly damaging 0.94
IGL01093:Dnmt1 APN 9 20909785 missense possibly damaging 0.88
IGL01160:Dnmt1 APN 9 20917319 missense possibly damaging 0.90
IGL01704:Dnmt1 APN 9 20910180 missense probably damaging 1.00
IGL02105:Dnmt1 APN 9 20907882 missense unknown
IGL02124:Dnmt1 APN 9 20908549 missense probably damaging 1.00
IGL02188:Dnmt1 APN 9 20941738 nonsense probably null
IGL02409:Dnmt1 APN 9 20926497 missense probably benign 0.00
IGL02579:Dnmt1 APN 9 20918120 missense possibly damaging 0.79
IGL02625:Dnmt1 APN 9 20927146 missense probably benign 0.01
IGL02794:Dnmt1 APN 9 20936551 missense probably benign
IGL02795:Dnmt1 APN 9 20927111 missense probably benign 0.12
IGL02938:Dnmt1 APN 9 20941373 missense probably benign 0.23
IGL03245:Dnmt1 APN 9 20915760 missense probably damaging 0.99
IGL03303:Dnmt1 APN 9 20926710 missense probably benign
B5639:Dnmt1 UTSW 9 20907968 splice site probably benign
PIT4576001:Dnmt1 UTSW 9 20911775 missense probably benign 0.28
R0071:Dnmt1 UTSW 9 20908620 missense probably damaging 0.99
R0180:Dnmt1 UTSW 9 20908620 missense probably damaging 0.99
R0368:Dnmt1 UTSW 9 20941757 missense probably damaging 0.99
R0387:Dnmt1 UTSW 9 20918213 missense probably damaging 1.00
R0529:Dnmt1 UTSW 9 20911550 missense probably damaging 1.00
R0532:Dnmt1 UTSW 9 20918556 splice site probably benign
R0612:Dnmt1 UTSW 9 20918193 missense probably damaging 0.98
R1109:Dnmt1 UTSW 9 20922388 missense probably damaging 1.00
R1298:Dnmt1 UTSW 9 20941456 missense probably benign
R1345:Dnmt1 UTSW 9 20908518 missense probably damaging 1.00
R1472:Dnmt1 UTSW 9 20932176 missense probably benign 0.28
R1654:Dnmt1 UTSW 9 20936574 missense possibly damaging 0.75
R1817:Dnmt1 UTSW 9 20927126 missense probably benign
R1836:Dnmt1 UTSW 9 20918246 missense probably damaging 1.00
R1957:Dnmt1 UTSW 9 20927146 missense probably benign 0.01
R1958:Dnmt1 UTSW 9 20927146 missense probably benign 0.01
R2097:Dnmt1 UTSW 9 20909788 missense probably benign 0.00
R2145:Dnmt1 UTSW 9 20937155 splice site probably benign
R2326:Dnmt1 UTSW 9 20924146 splice site probably benign
R4199:Dnmt1 UTSW 9 20938118 missense probably benign 0.00
R4456:Dnmt1 UTSW 9 20909842 missense probably damaging 1.00
R4518:Dnmt1 UTSW 9 20911978 missense probably benign 0.00
R4586:Dnmt1 UTSW 9 20926693 missense probably benign 0.05
R4836:Dnmt1 UTSW 9 20908558 missense probably damaging 1.00
R5014:Dnmt1 UTSW 9 20912254 missense probably benign 0.07
R5338:Dnmt1 UTSW 9 20952719 missense probably benign 0.44
R5385:Dnmt1 UTSW 9 20918480 missense probably damaging 1.00
R5579:Dnmt1 UTSW 9 20920205 missense probably damaging 1.00
R5645:Dnmt1 UTSW 9 20922147 missense probably damaging 1.00
R5719:Dnmt1 UTSW 9 20912595 missense possibly damaging 0.86
R5881:Dnmt1 UTSW 9 20952717 missense probably damaging 0.97
R6039:Dnmt1 UTSW 9 20926420 intron probably benign
R6039:Dnmt1 UTSW 9 20926420 intron probably benign
R6143:Dnmt1 UTSW 9 20927134 missense probably benign 0.30
R6342:Dnmt1 UTSW 9 20909793 nonsense probably null
R6953:Dnmt1 UTSW 9 20918526 missense probably benign
R6990:Dnmt1 UTSW 9 20915814 nonsense probably null
R7089:Dnmt1 UTSW 9 20908489 missense probably damaging 0.99
R7463:Dnmt1 UTSW 9 20912225 missense possibly damaging 0.86
R7522:Dnmt1 UTSW 9 20920202 missense probably damaging 0.99
R7695:Dnmt1 UTSW 9 20913985 missense probably null 1.00
R7785:Dnmt1 UTSW 9 20922049 missense probably damaging 0.98
R8037:Dnmt1 UTSW 9 20941564 missense probably damaging 0.99
R8038:Dnmt1 UTSW 9 20941564 missense probably damaging 0.99
RF003:Dnmt1 UTSW 9 20910131 nonsense probably null
RF004:Dnmt1 UTSW 9 20910127 nonsense probably null
RF011:Dnmt1 UTSW 9 20910128 nonsense probably null
RF011:Dnmt1 UTSW 9 20910144 nonsense probably null
RF012:Dnmt1 UTSW 9 20910123 nonsense probably null
RF015:Dnmt1 UTSW 9 20910124 nonsense probably null
RF015:Dnmt1 UTSW 9 20910129 nonsense probably null
RF017:Dnmt1 UTSW 9 20910126 nonsense probably null
RF021:Dnmt1 UTSW 9 20910132 nonsense probably null
RF023:Dnmt1 UTSW 9 20910131 nonsense probably null
RF024:Dnmt1 UTSW 9 20910130 nonsense probably null
RF024:Dnmt1 UTSW 9 20910138 small insertion probably benign
RF025:Dnmt1 UTSW 9 20910120 nonsense probably null
RF025:Dnmt1 UTSW 9 20910135 nonsense probably null
RF029:Dnmt1 UTSW 9 20910123 nonsense probably null
RF034:Dnmt1 UTSW 9 20910120 nonsense probably null
RF037:Dnmt1 UTSW 9 20910119 critical splice donor site probably benign
RF037:Dnmt1 UTSW 9 20910133 nonsense probably null
RF037:Dnmt1 UTSW 9 20910141 nonsense probably null
RF042:Dnmt1 UTSW 9 20910119 nonsense probably null
RF045:Dnmt1 UTSW 9 20910129 nonsense probably null
RF045:Dnmt1 UTSW 9 20910137 small insertion probably benign
RF047:Dnmt1 UTSW 9 20910125 nonsense probably null
RF048:Dnmt1 UTSW 9 20910126 nonsense probably null
RF054:Dnmt1 UTSW 9 20910139 nonsense probably null
RF055:Dnmt1 UTSW 9 20910128 nonsense probably null
RF055:Dnmt1 UTSW 9 20910135 nonsense probably null
RF055:Dnmt1 UTSW 9 20910136 small insertion probably benign
RF059:Dnmt1 UTSW 9 20910138 small insertion probably benign
RF059:Dnmt1 UTSW 9 20910139 nonsense probably null
RF060:Dnmt1 UTSW 9 20910142 nonsense probably null
RF061:Dnmt1 UTSW 9 20910130 nonsense probably null
X0026:Dnmt1 UTSW 9 20913914 missense probably damaging 1.00
Z1176:Dnmt1 UTSW 9 20915863 missense probably damaging 0.99
Z1176:Dnmt1 UTSW 9 20926554 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGCTGCCTTTCCAAAGTC -3'
(R):5'- TACCTATGTAGGAGCCCTCTG -3'

Sequencing Primer
(F):5'- CCAAAGTCATTTTGTCGGTTAATGGC -3'
(R):5'- ATGTAGGAGCCCTCTGACCTTG -3'
Posted On2018-04-27