Incidental Mutation 'R6374:Cd3e'
ID513699
Institutional Source Beutler Lab
Gene Symbol Cd3e
Ensembl Gene ENSMUSG00000032093
Gene NameCD3 antigen, epsilon polypeptide
SynonymsT3e, CD3, CD3epsilon
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6374 (G1)
Quality Score149.008
Status Validated
Chromosome9
Chromosomal Location44998740-45009627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45009363 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 12 (L12F)
Ref Sequence ENSEMBL: ENSMUSP00000099896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102832]
PDB Structure
CD3 Epsilon and gamma Ectodomain Fragment Complex in Single-Chain Construct [SOLUTION NMR]
CD3 EPSILON AND DELTA ECTODOMAIN FRAGMENT COMPLEX IN SINGLE-CHAIN CONSTRUCT [SOLUTION NMR]
Mouse CD3epsilon Cytoplasmic Tail [SOLUTION NMR]
Crystal structure of mouse cd3epsilon in complex with antibody 2C11 Fab [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000102832
AA Change: L12F

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099896
Gene: ENSMUSG00000032093
AA Change: L12F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 33 90 3.79e-13 SMART
transmembrane domain 111 133 N/A INTRINSIC
ITAM 167 187 2.96e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217486
Meta Mutation Damage Score 0.1202 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the CD3-epsilon polypeptide, which together with CD3-gamma, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. The epsilon polypeptide plays an essential role in T-cell development. Defects in this gene cause immunodeficiency. This gene has also been linked to a susceptibility to type I diabetes in women. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous null for this mutation lack peripherial T cells and have a block of thymocyte development at the DN3 stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,880 S293A possibly damaging Het
4932415D10Rik T A 10: 82,288,897 probably benign Het
5430401F13Rik A T 6: 131,552,929 Q162L unknown Het
Abca8a A T 11: 110,083,390 Y239* probably null Het
Aox3 T C 1: 58,172,161 I959T probably benign Het
Atad2b T C 12: 5,018,002 V1000A probably damaging Het
Atic C T 1: 71,564,941 T221M probably damaging Het
Atp1a2 C T 1: 172,289,375 R225H probably damaging Het
BC024139 A G 15: 76,120,457 probably null Het
Bpi A T 2: 158,272,054 T291S probably damaging Het
Ccdc170 C T 10: 4,549,746 Q556* probably null Het
Cdc42ep1 A T 15: 78,847,449 R31S probably damaging Het
Cyp21a1 G T 17: 34,804,136 probably null Het
Dnase1l3 A G 14: 7,974,115 M192T probably damaging Het
Dnmt1 A T 9: 20,924,045 H330Q possibly damaging Het
Enah T C 1: 181,923,580 E232G unknown Het
Etnppl C T 3: 130,620,693 T73I probably damaging Het
Fam83b T A 9: 76,492,907 I305F probably benign Het
Galnt15 T A 14: 32,058,159 I471N probably damaging Het
Gm19965 T A 1: 116,822,291 N567K probably benign Het
Golga1 T C 2: 39,034,068 Q435R probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Hao1 T G 2: 134,523,104 D201A probably benign Het
Heg1 T C 16: 33,727,129 L786P possibly damaging Het
Hnrnpll A T 17: 80,049,874 C238S possibly damaging Het
Hrg A G 16: 22,960,992 Y340C probably damaging Het
Kyat3 A T 3: 142,738,237 I411F probably damaging Het
Myo1a T C 10: 127,707,680 Y202H probably damaging Het
Nags T C 11: 102,146,511 C143R possibly damaging Het
Ncoa6 T C 2: 155,421,156 N453D probably damaging Het
Nup35 G T 2: 80,658,386 M322I probably benign Het
Olfr620 A G 7: 103,611,921 L144P probably benign Het
Oprl1 T C 2: 181,715,928 V69A probably damaging Het
Pappa2 T A 1: 158,956,645 Y265F probably damaging Het
Pcsk6 C T 7: 65,980,155 P343L possibly damaging Het
Peak1 C A 9: 56,257,666 D993Y probably damaging Het
Polr2a T C 11: 69,736,932 Y1383C probably damaging Het
Ppme1 A G 7: 100,341,065 S226P probably damaging Het
Prom1 C T 5: 44,055,983 C127Y probably damaging Het
Ptpn6 A T 6: 124,732,569 probably null Het
Reln T C 5: 22,080,714 E419G probably benign Het
Rnf32 C T 5: 29,225,268 Q362* probably null Het
Sbspon T C 1: 15,883,663 D131G probably benign Het
Scyl3 T C 1: 163,949,214 S392P probably benign Het
Shtn1 T A 19: 59,038,296 D121V possibly damaging Het
Sin3a A G 9: 57,117,481 T1042A probably benign Het
Sipa1l2 A T 8: 125,444,630 V1371D probably damaging Het
Slc20a2 T C 8: 22,565,652 V584A possibly damaging Het
Smc6 T A 12: 11,305,873 probably null Het
Specc1 C T 11: 62,156,592 T849I possibly damaging Het
Spta1 T A 1: 174,214,168 L1368H probably damaging Het
Sqle A G 15: 59,316,110 E89G possibly damaging Het
Strbp A G 2: 37,603,008 V422A probably damaging Het
Sult6b1 G T 17: 78,906,931 T21K probably benign Het
Tex15 A G 8: 33,575,912 E1790G probably damaging Het
Tmem88b T A 4: 155,785,764 probably benign Het
Traf3ip3 T C 1: 193,182,010 D355G possibly damaging Het
Trim24 T A 6: 37,953,549 V576E probably benign Het
Trim30c C T 7: 104,390,402 G62D probably benign Het
Trim66 T G 7: 109,486,062 K100N probably benign Het
Tsnaxip1 A T 8: 105,841,540 T313S possibly damaging Het
Ugt2b37 A T 5: 87,242,420 I389N probably damaging Het
Unc13a C T 8: 71,641,453 V1335M possibly damaging Het
Urah A G 7: 140,835,211 T5A probably benign Het
Usp34 T C 11: 23,438,914 Y2185H probably damaging Het
Usp44 T C 10: 93,856,310 S643P probably benign Het
Vars2 A G 17: 35,660,045 V631A probably damaging Het
Vmn2r11 G A 5: 109,053,813 T275I possibly damaging Het
Vmn2r54 C A 7: 12,615,493 V721F probably damaging Het
Vmn2r79 T C 7: 87,002,290 I299T probably benign Het
Vps13d T C 4: 145,122,681 T2387A probably damaging Het
Washc5 A T 15: 59,337,195 L610Q probably benign Het
Zbtb21 T C 16: 97,950,368 E905G probably damaging Het
Zfhx4 A G 3: 5,244,035 T774A probably damaging Het
Zfp534 T C 4: 147,674,842 I457V probably benign Het
Zfp964 T C 8: 69,659,344 Y29H possibly damaging Het
Znrf4 A G 17: 56,511,702 F202L probably damaging Het
Other mutations in Cd3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
cadence UTSW 9 45001128 missense probably damaging 1.00
tumormouse UTSW 9 45006150 intron probably benign
R0504:Cd3e UTSW 9 45002254 missense probably benign
R3237:Cd3e UTSW 9 45002310 nonsense probably null
R6054:Cd3e UTSW 9 45002161 missense possibly damaging 0.87
R6404:Cd3e UTSW 9 45001128 missense probably damaging 1.00
R6701:Cd3e UTSW 9 45001053 missense probably damaging 1.00
R7403:Cd3e UTSW 9 45002292 missense probably benign 0.00
X0025:Cd3e UTSW 9 45000976 splice site probably null
Predicted Primers PCR Primer
(F):5'- GATCAACCCAACTGATTTCCTTTG -3'
(R):5'- GTCTCTCCTTGTGAAGTGCC -3'

Sequencing Primer
(F):5'- TGCATGTCTCCTGAACTGTC -3'
(R):5'- CCCCCACTCTCCTTCATCCTAC -3'
Posted On2018-04-27