Incidental Mutation 'R6374:Atad2b'
ID513712
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene NameATPase family, AAA domain containing 2B
SynonymsD530031C13Rik, 1110014E10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6374 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location4917353-5047394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5018002 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1000 (V1000A)
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664] [ENSMUST00000218859]
Predicted Effect probably damaging
Transcript: ENSMUST00000045664
AA Change: V1000A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: V1000A

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218859
Meta Mutation Damage Score 0.4356 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,880 S293A possibly damaging Het
4932415D10Rik T A 10: 82,288,897 probably benign Het
5430401F13Rik A T 6: 131,552,929 Q162L unknown Het
Abca8a A T 11: 110,083,390 Y239* probably null Het
Aox3 T C 1: 58,172,161 I959T probably benign Het
Atic C T 1: 71,564,941 T221M probably damaging Het
Atp1a2 C T 1: 172,289,375 R225H probably damaging Het
BC024139 A G 15: 76,120,457 probably null Het
Bpi A T 2: 158,272,054 T291S probably damaging Het
Ccdc170 C T 10: 4,549,746 Q556* probably null Het
Cd3e G A 9: 45,009,363 L12F probably benign Het
Cdc42ep1 A T 15: 78,847,449 R31S probably damaging Het
Cyp21a1 G T 17: 34,804,136 probably null Het
Dnase1l3 A G 14: 7,974,115 M192T probably damaging Het
Dnmt1 A T 9: 20,924,045 H330Q possibly damaging Het
Enah T C 1: 181,923,580 E232G unknown Het
Etnppl C T 3: 130,620,693 T73I probably damaging Het
Fam83b T A 9: 76,492,907 I305F probably benign Het
Galnt15 T A 14: 32,058,159 I471N probably damaging Het
Gm19965 T A 1: 116,822,291 N567K probably benign Het
Golga1 T C 2: 39,034,068 Q435R probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Hao1 T G 2: 134,523,104 D201A probably benign Het
Heg1 T C 16: 33,727,129 L786P possibly damaging Het
Hnrnpll A T 17: 80,049,874 C238S possibly damaging Het
Hrg A G 16: 22,960,992 Y340C probably damaging Het
Kyat3 A T 3: 142,738,237 I411F probably damaging Het
Myo1a T C 10: 127,707,680 Y202H probably damaging Het
Nags T C 11: 102,146,511 C143R possibly damaging Het
Ncoa6 T C 2: 155,421,156 N453D probably damaging Het
Nup35 G T 2: 80,658,386 M322I probably benign Het
Olfr620 A G 7: 103,611,921 L144P probably benign Het
Oprl1 T C 2: 181,715,928 V69A probably damaging Het
Pappa2 T A 1: 158,956,645 Y265F probably damaging Het
Pcsk6 C T 7: 65,980,155 P343L possibly damaging Het
Peak1 C A 9: 56,257,666 D993Y probably damaging Het
Polr2a T C 11: 69,736,932 Y1383C probably damaging Het
Ppme1 A G 7: 100,341,065 S226P probably damaging Het
Prom1 C T 5: 44,055,983 C127Y probably damaging Het
Ptpn6 A T 6: 124,732,569 probably null Het
Reln T C 5: 22,080,714 E419G probably benign Het
Rnf32 C T 5: 29,225,268 Q362* probably null Het
Sbspon T C 1: 15,883,663 D131G probably benign Het
Scyl3 T C 1: 163,949,214 S392P probably benign Het
Shtn1 T A 19: 59,038,296 D121V possibly damaging Het
Sin3a A G 9: 57,117,481 T1042A probably benign Het
Sipa1l2 A T 8: 125,444,630 V1371D probably damaging Het
Slc20a2 T C 8: 22,565,652 V584A possibly damaging Het
Smc6 T A 12: 11,305,873 probably null Het
Specc1 C T 11: 62,156,592 T849I possibly damaging Het
Spta1 T A 1: 174,214,168 L1368H probably damaging Het
Sqle A G 15: 59,316,110 E89G possibly damaging Het
Strbp A G 2: 37,603,008 V422A probably damaging Het
Sult6b1 G T 17: 78,906,931 T21K probably benign Het
Tex15 A G 8: 33,575,912 E1790G probably damaging Het
Tmem88b T A 4: 155,785,764 probably benign Het
Traf3ip3 T C 1: 193,182,010 D355G possibly damaging Het
Trim24 T A 6: 37,953,549 V576E probably benign Het
Trim30c C T 7: 104,390,402 G62D probably benign Het
Trim66 T G 7: 109,486,062 K100N probably benign Het
Tsnaxip1 A T 8: 105,841,540 T313S possibly damaging Het
Ugt2b37 A T 5: 87,242,420 I389N probably damaging Het
Unc13a C T 8: 71,641,453 V1335M possibly damaging Het
Urah A G 7: 140,835,211 T5A probably benign Het
Usp34 T C 11: 23,438,914 Y2185H probably damaging Het
Usp44 T C 10: 93,856,310 S643P probably benign Het
Vars2 A G 17: 35,660,045 V631A probably damaging Het
Vmn2r11 G A 5: 109,053,813 T275I possibly damaging Het
Vmn2r54 C A 7: 12,615,493 V721F probably damaging Het
Vmn2r79 T C 7: 87,002,290 I299T probably benign Het
Vps13d T C 4: 145,122,681 T2387A probably damaging Het
Washc5 A T 15: 59,337,195 L610Q probably benign Het
Zbtb21 T C 16: 97,950,368 E905G probably damaging Het
Zfhx4 A G 3: 5,244,035 T774A probably damaging Het
Zfp534 T C 4: 147,674,842 I457V probably benign Het
Zfp964 T C 8: 69,659,344 Y29H possibly damaging Het
Znrf4 A G 17: 56,511,702 F202L probably damaging Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0894:Atad2b UTSW 12 4965915 missense probably damaging 1.00
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R5754:Atad2b UTSW 12 5010351 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R7648:Atad2b UTSW 12 5027182 critical splice donor site probably null
R8253:Atad2b UTSW 12 4974159 missense possibly damaging 0.54
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
R8708:Atad2b UTSW 12 4961253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCTGTTTCAGAGGTCAGG -3'
(R):5'- GGCTTTAATGTCGCCACAG -3'

Sequencing Primer
(F):5'- CAGGATGAGCACCATGAAGCTTTTC -3'
(R):5'- AATGTCGCCACAGTGTCC -3'
Posted On2018-04-27