Incidental Mutation 'R6337:Itga8'
ID 513730
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Name integrin alpha 8
Synonyms
MMRRC Submission 044491-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R6337 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 12111443-12306733 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 12258280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 261 (Y261*)
Ref Sequence ENSEMBL: ENSMUSP00000134154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
AlphaFold A2ARA8
Predicted Effect probably null
Transcript: ENSMUST00000028106
AA Change: Y261*
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: Y261*

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141477
Predicted Effect probably null
Transcript: ENSMUST00000172791
AA Change: Y261*
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: Y261*

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T G 3: 89,969,040 (GRCm39) V221G probably benign Het
Abca12 G A 1: 71,334,172 (GRCm39) A1110V probably damaging Het
Acsl6 C A 11: 54,231,368 (GRCm39) P462T probably damaging Het
Acsm5 G A 7: 119,133,458 (GRCm39) A208T probably benign Het
Adcyap1 T A 17: 93,509,709 (GRCm39) Y53* probably null Het
Adgrg7 T A 16: 56,572,788 (GRCm39) I343F probably damaging Het
Agl T A 3: 116,580,426 (GRCm39) K376M possibly damaging Het
Akna A G 4: 63,292,240 (GRCm39) Y1142H probably benign Het
Anks1b A T 10: 90,757,158 (GRCm39) T182S probably benign Het
Apol7e T A 15: 77,598,582 (GRCm39) Y16N possibly damaging Het
Bptf G T 11: 106,949,605 (GRCm39) T2238K possibly damaging Het
Ccdc87 A G 19: 4,889,829 (GRCm39) E107G probably benign Het
Ccng2 C T 5: 93,418,780 (GRCm39) A135V probably benign Het
Chd8 C A 14: 52,441,566 (GRCm39) R842L probably damaging Het
Cldn18 T A 9: 99,591,995 (GRCm39) T3S probably benign Het
Dhcr7 T C 7: 143,390,468 (GRCm39) probably null Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Dusp26 T C 8: 31,586,325 (GRCm39) V182A probably damaging Het
Eif3e T C 15: 43,115,692 (GRCm39) D358G possibly damaging Het
Epha3 A T 16: 63,388,806 (GRCm39) L814H probably damaging Het
Flnc A G 6: 29,454,318 (GRCm39) N1877S probably damaging Het
Fpgs A T 2: 32,577,953 (GRCm39) Y156* probably null Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gm5591 T C 7: 38,221,319 (GRCm39) D250G probably benign Het
Gtf2e2 C T 8: 34,266,043 (GRCm39) R240* probably null Het
Hells G T 19: 38,943,254 (GRCm39) Q519H probably benign Het
Hscb A G 5: 110,987,360 (GRCm39) probably null Het
Inpp5k T A 11: 75,537,640 (GRCm39) I350N probably damaging Het
Irf9 G A 14: 55,843,799 (GRCm39) V221I possibly damaging Het
Itprid2 G A 2: 79,485,463 (GRCm39) D506N probably damaging Het
Lama1 C T 17: 68,093,014 (GRCm39) T1684M probably benign Het
Lrp2 A T 2: 69,268,811 (GRCm39) H4157Q probably damaging Het
Nceh1 G T 3: 27,276,956 (GRCm39) R93L probably damaging Het
Nell2 A G 15: 95,283,025 (GRCm39) F339S probably damaging Het
Or2t49 A T 11: 58,392,838 (GRCm39) C181* probably null Het
Phf11a C A 14: 59,521,817 (GRCm39) C118F probably damaging Het
Purg A G 8: 33,876,451 (GRCm39) K30E possibly damaging Het
Qprt C T 7: 126,708,101 (GRCm39) R110H probably damaging Het
Robo2 T C 16: 73,725,039 (GRCm39) T1055A probably benign Het
Serpina3a T C 12: 104,079,137 (GRCm39) F10L probably benign Het
Sidt1 A T 16: 44,121,298 (GRCm39) probably null Het
Slc4a4 T A 5: 89,194,231 (GRCm39) M237K probably benign Het
Slitrk5 A T 14: 111,917,684 (GRCm39) D436V probably damaging Het
Snd1 T C 6: 28,888,288 (GRCm39) Y908H probably damaging Het
Sorcs1 A G 19: 50,132,562 (GRCm39) V1132A probably benign Het
Speer3 A G 5: 13,843,369 (GRCm39) E92G probably damaging Het
Strada T C 11: 106,064,143 (GRCm39) E58G possibly damaging Het
Tbx10 A T 19: 4,047,312 (GRCm39) K139* probably null Het
Tcf4 T C 18: 69,766,651 (GRCm39) Y25H probably damaging Het
Tmem108 C T 9: 103,376,960 (GRCm39) R163H possibly damaging Het
Top2b A G 14: 16,399,026 (GRCm38) T549A possibly damaging Het
Tpcn2 A G 7: 144,833,080 (GRCm39) I46T probably damaging Het
Uox C T 3: 146,330,332 (GRCm39) R163* probably null Het
Vipr2 T A 12: 116,086,363 (GRCm39) Y129* probably null Het
Vps37a A T 8: 40,993,749 (GRCm39) Q248L probably benign Het
Wrap53 T C 11: 69,468,511 (GRCm39) I179V probably benign Het
Zan G A 5: 137,450,750 (GRCm39) A1609V unknown Het
Zbtb17 G A 4: 141,190,694 (GRCm39) G171S probably benign Het
Zbtb5 G A 4: 44,993,459 (GRCm39) R642W probably damaging Het
Zfyve27 A G 19: 42,171,096 (GRCm39) probably null Het
Zup1 T C 10: 33,825,252 (GRCm39) N77D probably benign Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12,260,777 (GRCm39) nonsense probably null
IGL00820:Itga8 APN 2 12,237,703 (GRCm39) missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12,196,525 (GRCm39) missense probably benign
IGL01508:Itga8 APN 2 12,237,613 (GRCm39) missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12,165,123 (GRCm39) splice site probably benign
IGL01590:Itga8 APN 2 12,165,144 (GRCm39) missense probably damaging 1.00
IGL01743:Itga8 APN 2 12,270,144 (GRCm39) missense probably benign 0.04
IGL02634:Itga8 APN 2 12,145,289 (GRCm39) missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12,194,291 (GRCm39) missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12,196,010 (GRCm39) missense probably benign 0.00
IGL03218:Itga8 APN 2 12,115,836 (GRCm39) missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12,137,327 (GRCm39) missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12,234,903 (GRCm39) missense probably benign 0.19
R0196:Itga8 UTSW 2 12,209,540 (GRCm39) critical splice donor site probably null
R0356:Itga8 UTSW 2 12,187,532 (GRCm39) missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12,237,697 (GRCm39) missense probably damaging 1.00
R0530:Itga8 UTSW 2 12,196,627 (GRCm39) missense probably damaging 0.99
R0715:Itga8 UTSW 2 12,196,053 (GRCm39) splice site probably benign
R0800:Itga8 UTSW 2 12,198,362 (GRCm39) missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12,267,003 (GRCm39) splice site probably null
R1675:Itga8 UTSW 2 12,204,974 (GRCm39) missense probably damaging 0.99
R1758:Itga8 UTSW 2 12,270,144 (GRCm39) missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12,305,657 (GRCm39) missense probably damaging 1.00
R2187:Itga8 UTSW 2 12,199,231 (GRCm39) missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12,187,520 (GRCm39) missense probably benign 0.38
R2356:Itga8 UTSW 2 12,204,952 (GRCm39) missense probably benign
R2371:Itga8 UTSW 2 12,258,277 (GRCm39) missense probably damaging 1.00
R2412:Itga8 UTSW 2 12,306,526 (GRCm39) missense probably benign
R2440:Itga8 UTSW 2 12,183,491 (GRCm39) missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12,165,215 (GRCm39) missense probably damaging 0.98
R3730:Itga8 UTSW 2 12,198,321 (GRCm39) missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R3982:Itga8 UTSW 2 12,305,774 (GRCm39) missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4514:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4660:Itga8 UTSW 2 12,270,069 (GRCm39) missense probably damaging 1.00
R4890:Itga8 UTSW 2 12,198,102 (GRCm39) splice site probably benign
R5533:Itga8 UTSW 2 12,165,161 (GRCm39) missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12,270,139 (GRCm39) missense probably damaging 1.00
R5720:Itga8 UTSW 2 12,115,898 (GRCm39) missense probably damaging 0.99
R5749:Itga8 UTSW 2 12,266,889 (GRCm39) missense probably damaging 1.00
R5930:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12,137,297 (GRCm39) missense probably damaging 0.99
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6211:Itga8 UTSW 2 12,198,320 (GRCm39) missense probably damaging 1.00
R6442:Itga8 UTSW 2 12,234,954 (GRCm39) missense probably benign 0.00
R6491:Itga8 UTSW 2 12,209,587 (GRCm39) missense probably damaging 1.00
R6543:Itga8 UTSW 2 12,306,455 (GRCm39) missense probably damaging 0.99
R6574:Itga8 UTSW 2 12,234,972 (GRCm39) missense probably benign 0.17
R6760:Itga8 UTSW 2 12,306,451 (GRCm39) missense probably damaging 1.00
R6858:Itga8 UTSW 2 12,204,892 (GRCm39) missense probably benign 0.00
R6943:Itga8 UTSW 2 12,160,182 (GRCm39) critical splice donor site probably null
R7048:Itga8 UTSW 2 12,115,895 (GRCm39) missense probably damaging 0.99
R7203:Itga8 UTSW 2 12,234,906 (GRCm39) missense possibly damaging 0.77
R7266:Itga8 UTSW 2 12,237,712 (GRCm39) missense probably damaging 1.00
R7323:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R7540:Itga8 UTSW 2 12,115,848 (GRCm39) missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12,113,998 (GRCm39) missense probably damaging 1.00
R7748:Itga8 UTSW 2 12,235,050 (GRCm39) missense possibly damaging 0.80
R7848:Itga8 UTSW 2 12,196,548 (GRCm39) missense probably damaging 0.99
R8031:Itga8 UTSW 2 12,160,297 (GRCm39) missense probably benign
R8077:Itga8 UTSW 2 12,247,244 (GRCm39) missense probably benign 0.09
R8757:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8759:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8772:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8773:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8808:Itga8 UTSW 2 12,137,328 (GRCm39) nonsense probably null
R8898:Itga8 UTSW 2 12,145,206 (GRCm39) missense probably benign 0.05
R8962:Itga8 UTSW 2 12,196,045 (GRCm39) missense possibly damaging 0.94
R9056:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R9155:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R9354:Itga8 UTSW 2 12,237,668 (GRCm39) missense possibly damaging 0.94
R9563:Itga8 UTSW 2 12,165,219 (GRCm39) missense possibly damaging 0.83
R9589:Itga8 UTSW 2 12,237,701 (GRCm39) missense probably damaging 1.00
R9663:Itga8 UTSW 2 12,196,580 (GRCm39) missense probably benign 0.00
Z1176:Itga8 UTSW 2 12,306,643 (GRCm39) start gained probably benign
Z1176:Itga8 UTSW 2 12,266,947 (GRCm39) missense probably benign 0.01
Z1176:Itga8 UTSW 2 12,252,329 (GRCm39) missense probably damaging 1.00
Z1177:Itga8 UTSW 2 12,305,744 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GAGAATGTCAGTGAGCCTACAG -3'
(R):5'- TTGCTGAGCAAGAGCCTGAC -3'

Sequencing Primer
(F):5'- GTCAGTGAGCCTACAGAATATTAGC -3'
(R):5'- TGAGCAAGAGCCTGACCCTTG -3'
Posted On 2018-04-27