Incidental Mutation 'R6337:Lrp2'
ID 513732
Institutional Source Beutler Lab
Gene Symbol Lrp2
Ensembl Gene ENSMUSG00000027070
Gene Name low density lipoprotein receptor-related protein 2
Synonyms D230004K18Rik, b2b1625.2Clo, Megalin, Gp330
MMRRC Submission 044491-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6337 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 69254679-69416373 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 69268811 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 4157 (H4157Q)
Ref Sequence ENSEMBL: ENSMUSP00000079752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080953]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080953
AA Change: H4157Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079752
Gene: ENSMUSG00000027070
AA Change: H4157Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
LDLa 27 64 5.63e-13 SMART
LDLa 66 105 2.25e-12 SMART
EGF 107 143 2.59e1 SMART
LDLa 107 144 9.29e-14 SMART
LDLa 146 181 6.18e-10 SMART
LDLa 182 219 1.08e-14 SMART
LDLa 221 258 1.05e-12 SMART
LDLa 264 302 1.66e-10 SMART
EGF 310 346 3.23e0 SMART
EGF 350 385 2.32e-1 SMART
LY 414 457 3.88e-3 SMART
LY 458 500 1.17e-6 SMART
LY 501 547 5.96e-13 SMART
LY 548 590 1.94e-12 SMART
LY 591 634 2.66e0 SMART
EGF 661 704 7.76e-3 SMART
LY 732 774 1.76e0 SMART
LY 775 817 3.64e-8 SMART
LY 818 860 1.11e-3 SMART
LY 861 903 2.11e-13 SMART
LY 905 946 9.33e-1 SMART
EGF 972 1013 1.73e0 SMART
LDLa 1024 1061 1.05e-12 SMART
LDLa 1065 1103 4.65e-14 SMART
LDLa 1109 1146 3.63e-16 SMART
LDLa 1149 1186 5.5e-16 SMART
LDLa 1187 1225 1.43e-14 SMART
LDLa 1230 1269 2.1e-12 SMART
LDLa 1271 1308 3.63e-16 SMART
LDLa 1312 1351 4.69e-10 SMART
EGF 1353 1390 9.7e-4 SMART
EGF_CA 1391 1430 6.54e-10 SMART
LY 1457 1501 1.43e-1 SMART
LY 1502 1544 2e-14 SMART
LY 1545 1590 3.03e-14 SMART
LY 1591 1633 5.48e-12 SMART
LY 1635 1677 1.18e-2 SMART
EGF 1704 1742 5.2e-4 SMART
LY 1771 1812 1.68e1 SMART
LY 1813 1856 1.91e-2 SMART
LY 1859 1911 1.88e-10 SMART
LY 1912 1954 7.69e-7 SMART
LY 1955 1994 3e1 SMART
EGF 2022 2060 1.18e-2 SMART
LY 2088 2135 1.14e1 SMART
LY 2136 2182 2.11e-4 SMART
LY 2183 2226 2.22e-12 SMART
LY 2227 2269 1.24e-10 SMART
EGF 2346 2384 2.07e1 SMART
LY 2459 2501 9.91e-10 SMART
LY 2503 2543 1.48e-8 SMART
LY 2544 2586 6.85e-13 SMART
LY 2587 2627 8.13e-1 SMART
EGF_like 2655 2694 3.5e1 SMART
LDLa 2700 2739 2.86e-14 SMART
LDLa 2741 2778 8.09e-14 SMART
LDLa 2780 2820 3.19e-12 SMART
LDLa 2822 2862 6.94e-13 SMART
LDLa 2864 2903 9.29e-14 SMART
LDLa 2907 2947 4.79e-16 SMART
LDLa 2949 2992 8.41e-12 SMART
LDLa 2994 3031 1.08e-14 SMART
LDLa 3033 3072 1.83e-12 SMART
LDLa 3076 3113 1.16e-14 SMART
EGF 3115 3153 8.57e-5 SMART
EGF_CA 3154 3194 3.56e-11 SMART
LY 3221 3263 9.77e-9 SMART
LY 3264 3306 1.22e-9 SMART
LY 3312 3358 5.44e-7 SMART
LY 3359 3401 1.83e-13 SMART
LY 3402 3443 1.41e-5 SMART
EGF 3470 3511 8.91e-3 SMART
LDLa 3513 3552 1.79e-15 SMART
LDLa 3554 3593 9.89e-9 SMART
LDLa 3595 3634 3.07e-14 SMART
LDLa 3636 3675 3.34e-15 SMART
LDLa 3679 3718 1.39e-12 SMART
LDLa 3720 3758 3.83e-15 SMART
LDLa 3760 3797 7.15e-15 SMART
LDLa 3799 3836 2.86e-14 SMART
LDLa 3843 3882 2.38e-11 SMART
LDLa 3884 3924 3.66e-12 SMART
LDLa 3929 3966 1.93e-11 SMART
EGF 3971 4008 6.3e-3 SMART
EGF_CA 4009 4050 1.36e-7 SMART
low complexity region 4072 4084 N/A INTRINSIC
LY 4136 4178 6.2e-11 SMART
LY 4179 4222 4.32e-10 SMART
LY 4223 4266 3.78e-15 SMART
LY 4267 4306 4.53e1 SMART
EGF 4335 4367 3.46e0 SMART
EGF 4368 4413 1.53e-1 SMART
transmembrane domain 4425 4447 N/A INTRINSIC
low complexity region 4454 4472 N/A INTRINSIC
low complexity region 4616 4636 N/A INTRINSIC
Meta Mutation Damage Score 0.1802 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, low density lipoprotein-related protein 2 (LRP2) or megalin, is a multi-ligand endocytic receptor that is expressed in many different tissues but primarily in absorptive epithilial tissues such as the kidney. This glycoprotein has a large amino-terminal extracellular domain, a single transmembrane domain, and a short carboxy-terminal cytoplasmic tail. The extracellular ligand-binding-domains bind diverse macromolecules including albumin, apolipoproteins B and E, and lipoprotein lipase. The LRP2 protein is critical for the reuptake of numerous ligands, including lipoproteins, sterols, vitamin-binding proteins, and hormones. This protein also has a role in cell-signaling; extracellular ligands include parathyroid horomones and the morphogen sonic hedgehog while cytosolic ligands include MAP kinase scaffold proteins and JNK interacting proteins. Recycling of this membrane receptor is regulated by phosphorylation of its cytoplasmic domain. Mutations in this gene cause Donnai-Barrow syndrome (DBS) and facio-oculoacoustico-renal syndrome (FOAR).[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit lung and kidney epithelial defects, impaired B12 uptake, reduced proliferation of the neuroepithelium resulting in lack of olfactory bulbs, forebrain fusions, ventricular defects, and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T G 3: 89,969,040 (GRCm39) V221G probably benign Het
Abca12 G A 1: 71,334,172 (GRCm39) A1110V probably damaging Het
Acsl6 C A 11: 54,231,368 (GRCm39) P462T probably damaging Het
Acsm5 G A 7: 119,133,458 (GRCm39) A208T probably benign Het
Adcyap1 T A 17: 93,509,709 (GRCm39) Y53* probably null Het
Adgrg7 T A 16: 56,572,788 (GRCm39) I343F probably damaging Het
Agl T A 3: 116,580,426 (GRCm39) K376M possibly damaging Het
Akna A G 4: 63,292,240 (GRCm39) Y1142H probably benign Het
Anks1b A T 10: 90,757,158 (GRCm39) T182S probably benign Het
Apol7e T A 15: 77,598,582 (GRCm39) Y16N possibly damaging Het
Bptf G T 11: 106,949,605 (GRCm39) T2238K possibly damaging Het
Ccdc87 A G 19: 4,889,829 (GRCm39) E107G probably benign Het
Ccng2 C T 5: 93,418,780 (GRCm39) A135V probably benign Het
Chd8 C A 14: 52,441,566 (GRCm39) R842L probably damaging Het
Cldn18 T A 9: 99,591,995 (GRCm39) T3S probably benign Het
Dhcr7 T C 7: 143,390,468 (GRCm39) probably null Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Dusp26 T C 8: 31,586,325 (GRCm39) V182A probably damaging Het
Eif3e T C 15: 43,115,692 (GRCm39) D358G possibly damaging Het
Epha3 A T 16: 63,388,806 (GRCm39) L814H probably damaging Het
Flnc A G 6: 29,454,318 (GRCm39) N1877S probably damaging Het
Fpgs A T 2: 32,577,953 (GRCm39) Y156* probably null Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gm5591 T C 7: 38,221,319 (GRCm39) D250G probably benign Het
Gtf2e2 C T 8: 34,266,043 (GRCm39) R240* probably null Het
Hells G T 19: 38,943,254 (GRCm39) Q519H probably benign Het
Hscb A G 5: 110,987,360 (GRCm39) probably null Het
Inpp5k T A 11: 75,537,640 (GRCm39) I350N probably damaging Het
Irf9 G A 14: 55,843,799 (GRCm39) V221I possibly damaging Het
Itga8 A T 2: 12,258,280 (GRCm39) Y261* probably null Het
Itprid2 G A 2: 79,485,463 (GRCm39) D506N probably damaging Het
Lama1 C T 17: 68,093,014 (GRCm39) T1684M probably benign Het
Nceh1 G T 3: 27,276,956 (GRCm39) R93L probably damaging Het
Nell2 A G 15: 95,283,025 (GRCm39) F339S probably damaging Het
Or2t49 A T 11: 58,392,838 (GRCm39) C181* probably null Het
Phf11a C A 14: 59,521,817 (GRCm39) C118F probably damaging Het
Purg A G 8: 33,876,451 (GRCm39) K30E possibly damaging Het
Qprt C T 7: 126,708,101 (GRCm39) R110H probably damaging Het
Robo2 T C 16: 73,725,039 (GRCm39) T1055A probably benign Het
Serpina3a T C 12: 104,079,137 (GRCm39) F10L probably benign Het
Sidt1 A T 16: 44,121,298 (GRCm39) probably null Het
Slc4a4 T A 5: 89,194,231 (GRCm39) M237K probably benign Het
Slitrk5 A T 14: 111,917,684 (GRCm39) D436V probably damaging Het
Snd1 T C 6: 28,888,288 (GRCm39) Y908H probably damaging Het
Sorcs1 A G 19: 50,132,562 (GRCm39) V1132A probably benign Het
Speer3 A G 5: 13,843,369 (GRCm39) E92G probably damaging Het
Strada T C 11: 106,064,143 (GRCm39) E58G possibly damaging Het
Tbx10 A T 19: 4,047,312 (GRCm39) K139* probably null Het
Tcf4 T C 18: 69,766,651 (GRCm39) Y25H probably damaging Het
Tmem108 C T 9: 103,376,960 (GRCm39) R163H possibly damaging Het
Top2b A G 14: 16,399,026 (GRCm38) T549A possibly damaging Het
Tpcn2 A G 7: 144,833,080 (GRCm39) I46T probably damaging Het
Uox C T 3: 146,330,332 (GRCm39) R163* probably null Het
Vipr2 T A 12: 116,086,363 (GRCm39) Y129* probably null Het
Vps37a A T 8: 40,993,749 (GRCm39) Q248L probably benign Het
Wrap53 T C 11: 69,468,511 (GRCm39) I179V probably benign Het
Zan G A 5: 137,450,750 (GRCm39) A1609V unknown Het
Zbtb17 G A 4: 141,190,694 (GRCm39) G171S probably benign Het
Zbtb5 G A 4: 44,993,459 (GRCm39) R642W probably damaging Het
Zfyve27 A G 19: 42,171,096 (GRCm39) probably null Het
Zup1 T C 10: 33,825,252 (GRCm39) N77D probably benign Het
Other mutations in Lrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lrp2 APN 2 69,338,123 (GRCm39) missense probably damaging 1.00
IGL00594:Lrp2 APN 2 69,316,624 (GRCm39) missense probably benign 0.00
IGL00782:Lrp2 APN 2 69,331,989 (GRCm39) missense probably benign 0.14
IGL00821:Lrp2 APN 2 69,289,860 (GRCm39) missense probably damaging 1.00
IGL00897:Lrp2 APN 2 69,352,225 (GRCm39) missense possibly damaging 0.86
IGL01065:Lrp2 APN 2 69,299,780 (GRCm39) missense possibly damaging 0.94
IGL01087:Lrp2 APN 2 69,354,417 (GRCm39) missense probably damaging 1.00
IGL01095:Lrp2 APN 2 69,322,776 (GRCm39) nonsense probably null
IGL01131:Lrp2 APN 2 69,329,583 (GRCm39) missense probably damaging 1.00
IGL01350:Lrp2 APN 2 69,341,328 (GRCm39) missense probably damaging 0.96
IGL01352:Lrp2 APN 2 69,333,870 (GRCm39) missense possibly damaging 0.77
IGL01358:Lrp2 APN 2 69,382,814 (GRCm39) splice site probably benign
IGL01375:Lrp2 APN 2 69,308,910 (GRCm39) splice site probably benign
IGL01384:Lrp2 APN 2 69,313,846 (GRCm39) missense probably damaging 1.00
IGL01384:Lrp2 APN 2 69,284,156 (GRCm39) missense probably null 1.00
IGL01411:Lrp2 APN 2 69,312,611 (GRCm39) missense probably damaging 1.00
IGL01418:Lrp2 APN 2 69,355,630 (GRCm39) missense probably benign
IGL01444:Lrp2 APN 2 69,274,060 (GRCm39) missense possibly damaging 0.94
IGL01464:Lrp2 APN 2 69,302,783 (GRCm39) missense probably damaging 0.98
IGL01528:Lrp2 APN 2 69,322,804 (GRCm39) missense probably damaging 1.00
IGL01663:Lrp2 APN 2 69,259,050 (GRCm39) missense probably benign
IGL01761:Lrp2 APN 2 69,311,579 (GRCm39) missense possibly damaging 0.85
IGL01780:Lrp2 APN 2 69,316,528 (GRCm39) missense possibly damaging 0.66
IGL01994:Lrp2 APN 2 69,313,945 (GRCm39) missense probably benign 0.08
IGL02015:Lrp2 APN 2 69,357,922 (GRCm39) missense probably benign 0.00
IGL02104:Lrp2 APN 2 69,340,762 (GRCm39) missense probably damaging 1.00
IGL02132:Lrp2 APN 2 69,367,960 (GRCm39) missense probably benign 0.01
IGL02134:Lrp2 APN 2 69,343,723 (GRCm39) critical splice acceptor site probably null
IGL02197:Lrp2 APN 2 69,297,224 (GRCm39) missense probably benign 0.01
IGL02212:Lrp2 APN 2 69,281,608 (GRCm39) missense probably benign 0.00
IGL02240:Lrp2 APN 2 69,365,390 (GRCm39) missense probably benign
IGL02248:Lrp2 APN 2 69,313,152 (GRCm39) missense probably damaging 1.00
IGL02369:Lrp2 APN 2 69,294,980 (GRCm39) missense probably damaging 1.00
IGL02416:Lrp2 APN 2 69,299,977 (GRCm39) missense probably damaging 1.00
IGL02417:Lrp2 APN 2 69,291,649 (GRCm39) missense probably damaging 1.00
IGL02458:Lrp2 APN 2 69,352,117 (GRCm39) missense probably damaging 0.97
IGL02479:Lrp2 APN 2 69,295,145 (GRCm39) splice site probably benign
IGL02508:Lrp2 APN 2 69,333,774 (GRCm39) missense probably benign 0.04
IGL02751:Lrp2 APN 2 69,363,806 (GRCm39) missense possibly damaging 0.56
IGL02814:Lrp2 APN 2 69,337,080 (GRCm39) missense probably damaging 1.00
IGL02867:Lrp2 APN 2 69,382,794 (GRCm39) missense possibly damaging 0.67
IGL02889:Lrp2 APN 2 69,382,794 (GRCm39) missense possibly damaging 0.67
IGL02943:Lrp2 APN 2 69,285,854 (GRCm39) missense possibly damaging 0.86
IGL02948:Lrp2 APN 2 69,318,181 (GRCm39) missense probably damaging 1.00
IGL02960:Lrp2 APN 2 69,285,797 (GRCm39) splice site probably benign
IGL02990:Lrp2 APN 2 69,271,740 (GRCm39) missense possibly damaging 0.56
IGL03027:Lrp2 APN 2 69,367,897 (GRCm39) missense probably benign 0.43
IGL03038:Lrp2 APN 2 69,305,808 (GRCm39) missense probably damaging 0.99
IGL03064:Lrp2 APN 2 69,313,477 (GRCm39) missense probably damaging 0.98
IGL03107:Lrp2 APN 2 69,285,177 (GRCm39) missense probably damaging 1.00
IGL03141:Lrp2 APN 2 69,307,370 (GRCm39) missense probably damaging 0.99
IGL03154:Lrp2 APN 2 69,379,386 (GRCm39) missense probably damaging 1.00
IGL03155:Lrp2 APN 2 69,285,796 (GRCm39) splice site probably benign
IGL03163:Lrp2 APN 2 69,331,870 (GRCm39) nonsense probably null
IGL03164:Lrp2 APN 2 69,295,043 (GRCm39) missense probably damaging 1.00
IGL03169:Lrp2 APN 2 69,353,538 (GRCm39) missense probably damaging 1.00
IGL03174:Lrp2 APN 2 69,296,609 (GRCm39) missense probably damaging 1.00
IGL03189:Lrp2 APN 2 69,268,822 (GRCm39) splice site probably benign
IGL03288:Lrp2 APN 2 69,256,383 (GRCm39) missense probably benign 0.02
IGL03350:Lrp2 APN 2 69,268,797 (GRCm39) missense probably damaging 1.00
IGL03378:Lrp2 APN 2 69,261,496 (GRCm39) missense probably damaging 1.00
casual UTSW 2 69,329,607 (GRCm39) missense probably benign
nonchalant UTSW 2 69,319,673 (GRCm39) missense probably damaging 1.00
Presto UTSW 2 69,289,875 (GRCm39) nonsense probably null
relaxed UTSW 2 69,365,349 (GRCm39) missense probably damaging 1.00
unguarded UTSW 2 69,296,102 (GRCm39) missense probably benign 0.00
Unintended UTSW 2 69,348,787 (GRCm39) missense probably damaging 1.00
BB009:Lrp2 UTSW 2 69,256,371 (GRCm39) missense probably benign 0.00
BB019:Lrp2 UTSW 2 69,256,371 (GRCm39) missense probably benign 0.00
IGL02835:Lrp2 UTSW 2 69,335,648 (GRCm39) missense probably damaging 1.00
IGL03055:Lrp2 UTSW 2 69,288,792 (GRCm39) missense probably damaging 1.00
PIT4362001:Lrp2 UTSW 2 69,367,882 (GRCm39) missense probably damaging 1.00
PIT4504001:Lrp2 UTSW 2 69,305,747 (GRCm39) missense probably damaging 1.00
R0008:Lrp2 UTSW 2 69,346,895 (GRCm39) missense probably benign 0.42
R0008:Lrp2 UTSW 2 69,346,895 (GRCm39) missense probably benign 0.42
R0044:Lrp2 UTSW 2 69,357,899 (GRCm39) missense probably benign 0.01
R0044:Lrp2 UTSW 2 69,357,899 (GRCm39) missense probably damaging 0.96
R0048:Lrp2 UTSW 2 69,295,971 (GRCm39) missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69,305,756 (GRCm39) missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69,305,756 (GRCm39) missense probably damaging 1.00
R0103:Lrp2 UTSW 2 69,307,384 (GRCm39) missense probably benign
R0167:Lrp2 UTSW 2 69,256,002 (GRCm39) missense possibly damaging 0.95
R0226:Lrp2 UTSW 2 69,367,907 (GRCm39) missense probably null 1.00
R0243:Lrp2 UTSW 2 69,258,974 (GRCm39) missense probably benign 0.00
R0308:Lrp2 UTSW 2 69,313,326 (GRCm39) splice site probably benign
R0323:Lrp2 UTSW 2 69,299,983 (GRCm39) missense probably damaging 1.00
R0372:Lrp2 UTSW 2 69,365,387 (GRCm39) missense probably benign 0.10
R0374:Lrp2 UTSW 2 69,260,651 (GRCm39) missense probably damaging 1.00
R0391:Lrp2 UTSW 2 69,290,681 (GRCm39) splice site probably benign
R0391:Lrp2 UTSW 2 69,287,202 (GRCm39) missense probably damaging 0.99
R0395:Lrp2 UTSW 2 69,263,421 (GRCm39) missense possibly damaging 0.89
R0401:Lrp2 UTSW 2 69,309,492 (GRCm39) missense probably damaging 0.98
R0471:Lrp2 UTSW 2 69,355,578 (GRCm39) missense probably damaging 0.97
R0483:Lrp2 UTSW 2 69,338,145 (GRCm39) missense probably damaging 0.99
R0502:Lrp2 UTSW 2 69,341,361 (GRCm39) missense probably damaging 1.00
R0542:Lrp2 UTSW 2 69,258,998 (GRCm39) missense probably benign 0.00
R0544:Lrp2 UTSW 2 69,322,275 (GRCm39) missense probably benign 0.18
R0548:Lrp2 UTSW 2 69,367,982 (GRCm39) splice site probably benign
R0593:Lrp2 UTSW 2 69,297,350 (GRCm39) missense probably benign
R0608:Lrp2 UTSW 2 69,316,587 (GRCm39) missense probably benign 0.02
R0633:Lrp2 UTSW 2 69,278,464 (GRCm39) missense probably damaging 1.00
R0691:Lrp2 UTSW 2 69,281,724 (GRCm39) missense probably benign 0.19
R0718:Lrp2 UTSW 2 69,341,292 (GRCm39) missense probably damaging 1.00
R0737:Lrp2 UTSW 2 69,278,513 (GRCm39) missense probably damaging 0.96
R0771:Lrp2 UTSW 2 69,338,334 (GRCm39) missense probably damaging 1.00
R0784:Lrp2 UTSW 2 69,348,709 (GRCm39) missense probably benign 0.32
R0885:Lrp2 UTSW 2 69,312,697 (GRCm39) missense possibly damaging 0.75
R0947:Lrp2 UTSW 2 69,318,182 (GRCm39) missense probably damaging 1.00
R1235:Lrp2 UTSW 2 69,354,380 (GRCm39) missense probably damaging 1.00
R1293:Lrp2 UTSW 2 69,353,646 (GRCm39) splice site probably null
R1301:Lrp2 UTSW 2 69,258,948 (GRCm39) missense probably damaging 0.98
R1387:Lrp2 UTSW 2 69,287,262 (GRCm39) missense probably damaging 1.00
R1459:Lrp2 UTSW 2 69,313,738 (GRCm39) missense probably damaging 0.99
R1459:Lrp2 UTSW 2 69,290,821 (GRCm39) missense probably damaging 1.00
R1529:Lrp2 UTSW 2 69,353,526 (GRCm39) missense probably damaging 1.00
R1543:Lrp2 UTSW 2 69,331,074 (GRCm39) missense probably damaging 1.00
R1546:Lrp2 UTSW 2 69,332,954 (GRCm39) missense probably damaging 1.00
R1550:Lrp2 UTSW 2 69,333,005 (GRCm39) missense possibly damaging 0.74
R1590:Lrp2 UTSW 2 69,297,107 (GRCm39) critical splice donor site probably null
R1689:Lrp2 UTSW 2 69,333,873 (GRCm39) missense probably benign 0.09
R1693:Lrp2 UTSW 2 69,340,762 (GRCm39) missense probably damaging 1.00
R1753:Lrp2 UTSW 2 69,326,833 (GRCm39) missense possibly damaging 0.87
R1799:Lrp2 UTSW 2 69,333,874 (GRCm39) missense probably benign 0.04
R1834:Lrp2 UTSW 2 69,297,224 (GRCm39) missense probably benign 0.01
R1921:Lrp2 UTSW 2 69,353,631 (GRCm39) missense probably damaging 1.00
R2000:Lrp2 UTSW 2 69,297,434 (GRCm39) missense probably damaging 1.00
R2077:Lrp2 UTSW 2 69,338,187 (GRCm39) missense probably damaging 1.00
R2092:Lrp2 UTSW 2 69,366,365 (GRCm39) missense probably benign 0.25
R2093:Lrp2 UTSW 2 69,366,365 (GRCm39) missense probably benign 0.25
R2108:Lrp2 UTSW 2 69,336,968 (GRCm39) missense possibly damaging 0.75
R2117:Lrp2 UTSW 2 69,313,729 (GRCm39) missense probably benign 0.05
R2122:Lrp2 UTSW 2 69,314,051 (GRCm39) missense probably damaging 1.00
R2134:Lrp2 UTSW 2 69,341,411 (GRCm39) missense probably damaging 1.00
R2207:Lrp2 UTSW 2 69,297,372 (GRCm39) missense possibly damaging 0.94
R2248:Lrp2 UTSW 2 69,341,354 (GRCm39) missense probably damaging 1.00
R2264:Lrp2 UTSW 2 69,312,710 (GRCm39) missense possibly damaging 0.88
R2316:Lrp2 UTSW 2 69,322,191 (GRCm39) missense possibly damaging 0.75
R2513:Lrp2 UTSW 2 69,336,718 (GRCm39) splice site probably null
R2984:Lrp2 UTSW 2 69,256,158 (GRCm39) splice site probably null
R3085:Lrp2 UTSW 2 69,297,479 (GRCm39) missense probably benign 0.05
R3103:Lrp2 UTSW 2 69,262,328 (GRCm39) missense probably benign 0.00
R3727:Lrp2 UTSW 2 69,340,773 (GRCm39) missense probably damaging 1.00
R3730:Lrp2 UTSW 2 69,294,923 (GRCm39) missense probably damaging 0.99
R3730:Lrp2 UTSW 2 69,365,251 (GRCm39) critical splice donor site probably null
R3731:Lrp2 UTSW 2 69,294,923 (GRCm39) missense probably damaging 0.99
R3731:Lrp2 UTSW 2 69,365,251 (GRCm39) critical splice donor site probably null
R3764:Lrp2 UTSW 2 69,326,680 (GRCm39) missense probably damaging 1.00
R3768:Lrp2 UTSW 2 69,335,449 (GRCm39) missense probably benign 0.34
R3778:Lrp2 UTSW 2 69,339,548 (GRCm39) missense probably benign 0.00
R3808:Lrp2 UTSW 2 69,331,892 (GRCm39) missense probably damaging 1.00
R3809:Lrp2 UTSW 2 69,331,892 (GRCm39) missense probably damaging 1.00
R3813:Lrp2 UTSW 2 69,294,923 (GRCm39) missense probably damaging 0.99
R3828:Lrp2 UTSW 2 69,256,356 (GRCm39) missense probably benign 0.03
R3852:Lrp2 UTSW 2 69,367,909 (GRCm39) missense probably damaging 0.96
R3877:Lrp2 UTSW 2 69,289,816 (GRCm39) critical splice donor site probably null
R3877:Lrp2 UTSW 2 69,379,391 (GRCm39) missense probably damaging 1.00
R3922:Lrp2 UTSW 2 69,336,720 (GRCm39) missense probably benign
R4081:Lrp2 UTSW 2 69,343,617 (GRCm39) missense probably damaging 0.98
R4082:Lrp2 UTSW 2 69,343,617 (GRCm39) missense probably damaging 0.98
R4118:Lrp2 UTSW 2 69,260,606 (GRCm39) critical splice donor site probably null
R4193:Lrp2 UTSW 2 69,297,487 (GRCm39) missense probably damaging 1.00
R4284:Lrp2 UTSW 2 69,310,438 (GRCm39) missense possibly damaging 0.95
R4322:Lrp2 UTSW 2 69,256,335 (GRCm39) nonsense probably null
R4352:Lrp2 UTSW 2 69,262,526 (GRCm39) critical splice donor site probably null
R4407:Lrp2 UTSW 2 69,332,861 (GRCm39) missense probably damaging 1.00
R4408:Lrp2 UTSW 2 69,297,513 (GRCm39) missense probably benign 0.09
R4416:Lrp2 UTSW 2 69,357,575 (GRCm39) missense probably benign 0.18
R4426:Lrp2 UTSW 2 69,336,692 (GRCm39) missense probably benign 0.00
R4510:Lrp2 UTSW 2 69,310,406 (GRCm39) missense possibly damaging 0.58
R4511:Lrp2 UTSW 2 69,310,406 (GRCm39) missense possibly damaging 0.58
R4553:Lrp2 UTSW 2 69,343,629 (GRCm39) missense probably benign 0.13
R4591:Lrp2 UTSW 2 69,366,419 (GRCm39) missense probably damaging 1.00
R4612:Lrp2 UTSW 2 69,288,771 (GRCm39) nonsense probably null
R4622:Lrp2 UTSW 2 69,290,693 (GRCm39) missense possibly damaging 0.87
R4632:Lrp2 UTSW 2 69,319,473 (GRCm39) splice site probably null
R4633:Lrp2 UTSW 2 69,291,761 (GRCm39) missense probably benign 0.16
R4636:Lrp2 UTSW 2 69,266,983 (GRCm39) missense possibly damaging 0.93
R4657:Lrp2 UTSW 2 69,297,337 (GRCm39) missense probably damaging 1.00
R4667:Lrp2 UTSW 2 69,319,642 (GRCm39) missense probably benign 0.02
R4712:Lrp2 UTSW 2 69,336,895 (GRCm39) missense probably damaging 1.00
R4713:Lrp2 UTSW 2 69,318,310 (GRCm39) missense probably damaging 1.00
R4720:Lrp2 UTSW 2 69,311,517 (GRCm39) missense probably damaging 0.99
R4732:Lrp2 UTSW 2 69,363,899 (GRCm39) missense probably benign
R4733:Lrp2 UTSW 2 69,363,899 (GRCm39) missense probably benign
R4777:Lrp2 UTSW 2 69,312,608 (GRCm39) missense probably damaging 1.00
R4779:Lrp2 UTSW 2 69,290,059 (GRCm39) missense possibly damaging 0.75
R4786:Lrp2 UTSW 2 69,368,300 (GRCm39) missense probably damaging 1.00
R4842:Lrp2 UTSW 2 69,299,755 (GRCm39) missense probably benign 0.06
R4845:Lrp2 UTSW 2 69,339,585 (GRCm39) missense possibly damaging 0.71
R4846:Lrp2 UTSW 2 69,309,457 (GRCm39) missense probably damaging 1.00
R4938:Lrp2 UTSW 2 69,302,712 (GRCm39) missense probably damaging 0.98
R4951:Lrp2 UTSW 2 69,366,332 (GRCm39) missense probably damaging 1.00
R4990:Lrp2 UTSW 2 69,311,732 (GRCm39) missense probably benign 0.01
R5075:Lrp2 UTSW 2 69,296,102 (GRCm39) missense probably benign 0.00
R5078:Lrp2 UTSW 2 69,331,874 (GRCm39) missense possibly damaging 0.93
R5102:Lrp2 UTSW 2 69,319,502 (GRCm39) missense probably damaging 0.98
R5124:Lrp2 UTSW 2 69,331,834 (GRCm39) missense probably damaging 0.97
R5131:Lrp2 UTSW 2 69,260,686 (GRCm39) missense possibly damaging 0.74
R5141:Lrp2 UTSW 2 69,382,693 (GRCm39) splice site probably null
R5223:Lrp2 UTSW 2 69,354,397 (GRCm39) missense probably damaging 0.99
R5236:Lrp2 UTSW 2 69,287,163 (GRCm39) splice site probably null
R5267:Lrp2 UTSW 2 69,379,322 (GRCm39) missense possibly damaging 0.83
R5290:Lrp2 UTSW 2 69,343,698 (GRCm39) missense probably damaging 1.00
R5333:Lrp2 UTSW 2 69,355,572 (GRCm39) missense probably benign 0.01
R5355:Lrp2 UTSW 2 69,285,182 (GRCm39) nonsense probably null
R5356:Lrp2 UTSW 2 69,295,052 (GRCm39) missense possibly damaging 0.74
R5369:Lrp2 UTSW 2 69,289,904 (GRCm39) missense probably benign 0.04
R5486:Lrp2 UTSW 2 69,267,809 (GRCm39) missense probably benign 0.04
R5554:Lrp2 UTSW 2 69,382,768 (GRCm39) missense possibly damaging 0.92
R5584:Lrp2 UTSW 2 69,281,632 (GRCm39) missense probably damaging 1.00
R5585:Lrp2 UTSW 2 69,294,968 (GRCm39) missense possibly damaging 0.77
R5587:Lrp2 UTSW 2 69,329,607 (GRCm39) missense probably benign
R5605:Lrp2 UTSW 2 69,353,643 (GRCm39) missense probably damaging 1.00
R5637:Lrp2 UTSW 2 69,302,762 (GRCm39) missense probably damaging 1.00
R5647:Lrp2 UTSW 2 69,350,258 (GRCm39) missense probably null 0.80
R5686:Lrp2 UTSW 2 69,341,405 (GRCm39) missense possibly damaging 0.88
R5691:Lrp2 UTSW 2 69,332,897 (GRCm39) missense probably damaging 1.00
R5724:Lrp2 UTSW 2 69,281,726 (GRCm39) missense probably damaging 0.99
R5726:Lrp2 UTSW 2 69,339,491 (GRCm39) missense probably damaging 1.00
R5743:Lrp2 UTSW 2 69,297,221 (GRCm39) missense probably damaging 1.00
R5777:Lrp2 UTSW 2 69,285,869 (GRCm39) missense probably damaging 1.00
R5841:Lrp2 UTSW 2 69,310,497 (GRCm39) missense probably benign 0.00
R5892:Lrp2 UTSW 2 69,273,120 (GRCm39) missense probably benign
R5951:Lrp2 UTSW 2 69,326,667 (GRCm39) splice site probably null
R5974:Lrp2 UTSW 2 69,289,892 (GRCm39) missense probably damaging 1.00
R5980:Lrp2 UTSW 2 69,365,349 (GRCm39) missense probably damaging 1.00
R6046:Lrp2 UTSW 2 69,337,098 (GRCm39) missense probably damaging 1.00
R6113:Lrp2 UTSW 2 69,313,901 (GRCm39) missense possibly damaging 0.76
R6146:Lrp2 UTSW 2 69,341,345 (GRCm39) missense probably benign 0.00
R6177:Lrp2 UTSW 2 69,340,763 (GRCm39) frame shift probably null
R6180:Lrp2 UTSW 2 69,333,868 (GRCm39) missense possibly damaging 0.85
R6219:Lrp2 UTSW 2 69,299,822 (GRCm39) missense probably damaging 1.00
R6228:Lrp2 UTSW 2 69,312,710 (GRCm39) missense possibly damaging 0.88
R6265:Lrp2 UTSW 2 69,296,684 (GRCm39) missense probably damaging 1.00
R6312:Lrp2 UTSW 2 69,267,025 (GRCm39) missense probably damaging 1.00
R6376:Lrp2 UTSW 2 69,313,787 (GRCm39) missense probably benign 0.02
R6385:Lrp2 UTSW 2 69,326,128 (GRCm39) missense probably benign 0.22
R6429:Lrp2 UTSW 2 69,291,631 (GRCm39) missense probably damaging 1.00
R6458:Lrp2 UTSW 2 69,335,500 (GRCm39) missense probably benign 0.00
R6524:Lrp2 UTSW 2 69,266,983 (GRCm39) missense possibly damaging 0.93
R6555:Lrp2 UTSW 2 69,339,647 (GRCm39) missense probably benign 0.00
R6594:Lrp2 UTSW 2 69,270,267 (GRCm39) missense possibly damaging 0.58
R6599:Lrp2 UTSW 2 69,299,749 (GRCm39) missense probably damaging 1.00
R6655:Lrp2 UTSW 2 69,284,202 (GRCm39) missense probably benign 0.01
R6718:Lrp2 UTSW 2 69,314,124 (GRCm39) missense probably benign 0.09
R6736:Lrp2 UTSW 2 69,278,555 (GRCm39) missense probably benign 0.02
R6738:Lrp2 UTSW 2 69,288,832 (GRCm39) missense probably damaging 0.97
R6799:Lrp2 UTSW 2 69,314,248 (GRCm39) missense probably damaging 1.00
R6846:Lrp2 UTSW 2 69,348,787 (GRCm39) missense probably damaging 1.00
R6856:Lrp2 UTSW 2 69,343,612 (GRCm39) missense probably damaging 1.00
R6861:Lrp2 UTSW 2 69,343,721 (GRCm39) missense possibly damaging 0.77
R6888:Lrp2 UTSW 2 69,354,485 (GRCm39) missense probably damaging 0.98
R6897:Lrp2 UTSW 2 69,340,846 (GRCm39) missense probably benign
R6902:Lrp2 UTSW 2 69,289,847 (GRCm39) missense probably damaging 1.00
R6908:Lrp2 UTSW 2 69,302,709 (GRCm39) missense probably damaging 1.00
R6918:Lrp2 UTSW 2 69,319,649 (GRCm39) missense probably damaging 1.00
R6989:Lrp2 UTSW 2 69,302,799 (GRCm39) missense probably damaging 1.00
R7022:Lrp2 UTSW 2 69,313,552 (GRCm39) missense probably damaging 1.00
R7025:Lrp2 UTSW 2 69,313,372 (GRCm39) missense possibly damaging 0.90
R7026:Lrp2 UTSW 2 69,352,131 (GRCm39) missense probably damaging 0.97
R7138:Lrp2 UTSW 2 69,296,089 (GRCm39) missense possibly damaging 0.94
R7145:Lrp2 UTSW 2 69,285,152 (GRCm39) critical splice donor site probably null
R7150:Lrp2 UTSW 2 69,318,395 (GRCm39) missense probably damaging 0.99
R7165:Lrp2 UTSW 2 69,336,917 (GRCm39) missense probably damaging 0.99
R7174:Lrp2 UTSW 2 69,263,416 (GRCm39) missense probably benign 0.11
R7204:Lrp2 UTSW 2 69,302,877 (GRCm39) missense probably benign 0.25
R7275:Lrp2 UTSW 2 69,289,875 (GRCm39) nonsense probably null
R7278:Lrp2 UTSW 2 69,316,696 (GRCm39) missense probably damaging 1.00
R7296:Lrp2 UTSW 2 69,312,725 (GRCm39) missense probably benign 0.04
R7315:Lrp2 UTSW 2 69,322,166 (GRCm39) missense probably damaging 0.98
R7342:Lrp2 UTSW 2 69,309,634 (GRCm39) missense possibly damaging 0.95
R7351:Lrp2 UTSW 2 69,278,486 (GRCm39) missense probably damaging 1.00
R7352:Lrp2 UTSW 2 69,302,741 (GRCm39) missense probably benign 0.04
R7366:Lrp2 UTSW 2 69,314,150 (GRCm39) missense probably damaging 1.00
R7373:Lrp2 UTSW 2 69,331,036 (GRCm39) missense probably damaging 1.00
R7446:Lrp2 UTSW 2 69,290,018 (GRCm39) missense probably damaging 0.99
R7446:Lrp2 UTSW 2 69,262,557 (GRCm39) missense probably damaging 1.00
R7451:Lrp2 UTSW 2 69,343,677 (GRCm39) missense probably damaging 1.00
R7492:Lrp2 UTSW 2 69,367,925 (GRCm39) missense probably damaging 0.99
R7571:Lrp2 UTSW 2 69,346,747 (GRCm39) missense probably damaging 1.00
R7638:Lrp2 UTSW 2 69,307,352 (GRCm39) critical splice donor site probably null
R7664:Lrp2 UTSW 2 69,337,076 (GRCm39) missense probably damaging 1.00
R7686:Lrp2 UTSW 2 69,319,581 (GRCm39) missense probably damaging 1.00
R7711:Lrp2 UTSW 2 69,309,687 (GRCm39) critical splice acceptor site probably null
R7737:Lrp2 UTSW 2 69,326,782 (GRCm39) missense possibly damaging 0.77
R7763:Lrp2 UTSW 2 69,333,732 (GRCm39) missense probably damaging 0.99
R7775:Lrp2 UTSW 2 69,331,883 (GRCm39) missense possibly damaging 0.74
R7824:Lrp2 UTSW 2 69,331,883 (GRCm39) missense possibly damaging 0.74
R7840:Lrp2 UTSW 2 69,295,128 (GRCm39) missense probably damaging 0.98
R7878:Lrp2 UTSW 2 69,338,153 (GRCm39) missense probably damaging 1.00
R7878:Lrp2 UTSW 2 69,338,154 (GRCm39) missense probably damaging 1.00
R7895:Lrp2 UTSW 2 69,288,823 (GRCm39) missense probably damaging 0.97
R7898:Lrp2 UTSW 2 69,271,710 (GRCm39) missense probably benign 0.00
R7912:Lrp2 UTSW 2 69,259,016 (GRCm39) missense probably benign 0.03
R7923:Lrp2 UTSW 2 69,268,732 (GRCm39) missense possibly damaging 0.75
R7932:Lrp2 UTSW 2 69,256,371 (GRCm39) missense probably benign 0.00
R7940:Lrp2 UTSW 2 69,262,541 (GRCm39) missense possibly damaging 0.91
R7954:Lrp2 UTSW 2 69,333,867 (GRCm39) missense possibly damaging 0.61
R8007:Lrp2 UTSW 2 69,336,849 (GRCm39) missense probably benign 0.02
R8084:Lrp2 UTSW 2 69,339,713 (GRCm39) missense probably damaging 0.97
R8087:Lrp2 UTSW 2 69,278,473 (GRCm39) missense probably damaging 1.00
R8090:Lrp2 UTSW 2 69,295,089 (GRCm39) missense possibly damaging 0.94
R8110:Lrp2 UTSW 2 69,336,797 (GRCm39) missense probably benign
R8129:Lrp2 UTSW 2 69,260,624 (GRCm39) missense possibly damaging 0.75
R8155:Lrp2 UTSW 2 69,313,342 (GRCm39) missense possibly damaging 0.74
R8182:Lrp2 UTSW 2 69,319,673 (GRCm39) missense probably damaging 1.00
R8239:Lrp2 UTSW 2 69,311,611 (GRCm39) nonsense probably null
R8247:Lrp2 UTSW 2 69,261,431 (GRCm39) missense possibly damaging 0.76
R8327:Lrp2 UTSW 2 69,322,268 (GRCm39) missense probably damaging 1.00
R8355:Lrp2 UTSW 2 69,346,828 (GRCm39) missense probably damaging 0.99
R8404:Lrp2 UTSW 2 69,344,585 (GRCm39) nonsense probably null
R8427:Lrp2 UTSW 2 69,281,641 (GRCm39) missense probably damaging 0.97
R8463:Lrp2 UTSW 2 69,322,250 (GRCm39) missense probably damaging 1.00
R8502:Lrp2 UTSW 2 69,344,585 (GRCm39) nonsense probably null
R8529:Lrp2 UTSW 2 69,330,986 (GRCm39) missense probably damaging 0.96
R8673:Lrp2 UTSW 2 69,302,804 (GRCm39) missense probably damaging 1.00
R8698:Lrp2 UTSW 2 69,288,767 (GRCm39) missense probably benign 0.37
R8698:Lrp2 UTSW 2 69,278,583 (GRCm39) missense probably benign 0.39
R8708:Lrp2 UTSW 2 69,289,957 (GRCm39) missense probably damaging 1.00
R8716:Lrp2 UTSW 2 69,274,138 (GRCm39) missense probably benign 0.04
R8723:Lrp2 UTSW 2 69,316,648 (GRCm39) missense probably damaging 1.00
R8787:Lrp2 UTSW 2 69,382,745 (GRCm39) missense probably damaging 1.00
R8903:Lrp2 UTSW 2 69,379,382 (GRCm39) missense possibly damaging 0.68
R8944:Lrp2 UTSW 2 69,341,348 (GRCm39) missense probably damaging 1.00
R9069:Lrp2 UTSW 2 69,331,996 (GRCm39) missense probably damaging 1.00
R9076:Lrp2 UTSW 2 69,350,260 (GRCm39) missense probably benign 0.01
R9155:Lrp2 UTSW 2 69,291,713 (GRCm39) nonsense probably null
R9173:Lrp2 UTSW 2 69,299,731 (GRCm39) missense probably damaging 1.00
R9254:Lrp2 UTSW 2 69,333,891 (GRCm39) missense probably benign 0.09
R9256:Lrp2 UTSW 2 69,341,303 (GRCm39) missense probably benign 0.03
R9291:Lrp2 UTSW 2 69,310,379 (GRCm39) missense probably damaging 1.00
R9335:Lrp2 UTSW 2 69,258,983 (GRCm39) missense probably benign 0.01
R9357:Lrp2 UTSW 2 69,336,917 (GRCm39) missense probably damaging 0.99
R9368:Lrp2 UTSW 2 69,357,979 (GRCm39) missense probably damaging 0.99
R9453:Lrp2 UTSW 2 69,288,832 (GRCm39) missense probably damaging 1.00
R9546:Lrp2 UTSW 2 69,287,165 (GRCm39) critical splice donor site probably null
R9554:Lrp2 UTSW 2 69,261,497 (GRCm39) missense probably damaging 1.00
R9597:Lrp2 UTSW 2 69,260,703 (GRCm39) missense probably benign 0.02
R9601:Lrp2 UTSW 2 69,289,928 (GRCm39) missense probably damaging 1.00
R9623:Lrp2 UTSW 2 69,307,423 (GRCm39) missense probably benign 0.09
RF016:Lrp2 UTSW 2 69,339,549 (GRCm39) missense probably benign
X0011:Lrp2 UTSW 2 69,350,342 (GRCm39) missense probably damaging 1.00
X0023:Lrp2 UTSW 2 69,266,944 (GRCm39) missense probably damaging 0.99
Z1176:Lrp2 UTSW 2 69,338,225 (GRCm39) missense possibly damaging 0.88
Z1176:Lrp2 UTSW 2 69,310,386 (GRCm39) missense possibly damaging 0.66
Z1177:Lrp2 UTSW 2 69,326,812 (GRCm39) missense probably damaging 1.00
Z1177:Lrp2 UTSW 2 69,302,797 (GRCm39) missense probably benign 0.03
Z1177:Lrp2 UTSW 2 69,281,624 (GRCm39) missense probably damaging 1.00
Z1177:Lrp2 UTSW 2 69,339,633 (GRCm39) missense probably benign 0.00
Z1177:Lrp2 UTSW 2 69,331,985 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTGTAAGCAGATGGATTTTCATG -3'
(R):5'- TCTGCCTATGGAAGCATGTGAC -3'

Sequencing Primer
(F):5'- GCAGATGGATTTTCATGTATATCCC -3'
(R):5'- CTCATAAAAATTGAGATGGGCGGTC -3'
Posted On 2018-04-27