Incidental Mutation 'R6337:Nceh1'
ID513734
Institutional Source Beutler Lab
Gene Symbol Nceh1
Ensembl Gene ENSMUSG00000027698
Gene Nameneutral cholesterol ester hydrolase 1
SynonymsAadacl1, mKIAA1363, B230106I24Rik, CPO-BP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6337 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location27182965-27284608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 27222807 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 93 (R93L)
Ref Sequence ENSEMBL: ENSMUSP00000088829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046515] [ENSMUST00000091284] [ENSMUST00000138947]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046515
AA Change: R93L

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045864
Gene: ENSMUSG00000027698
AA Change: R93L

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Abhydrolase_3 109 290 6.6e-36 PFAM
Pfam:Abhydrolase_3 294 382 3.6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091284
AA Change: R93L

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088829
Gene: ENSMUSG00000027698
AA Change: R93L

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Abhydrolase_3 109 152 6.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129412
Predicted Effect probably benign
Transcript: ENSMUST00000138947
SMART Domains Protein: ENSMUSP00000115209
Gene: ENSMUSG00000027698

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140872
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal organophosphorus metabolism and cholesterol homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T G 3: 90,061,733 V221G probably benign Het
Abca12 G A 1: 71,295,013 A1110V probably damaging Het
Acsl6 C A 11: 54,340,542 P462T probably damaging Het
Acsm5 G A 7: 119,534,235 A208T probably benign Het
Adcyap1 T A 17: 93,202,281 Y53* probably null Het
Adgrg7 T A 16: 56,752,425 I343F probably damaging Het
Agl T A 3: 116,786,777 K376M possibly damaging Het
Akna A G 4: 63,374,003 Y1142H probably benign Het
Anks1b A T 10: 90,921,296 T182S probably benign Het
Apol7e T A 15: 77,714,382 Y16N possibly damaging Het
Bptf G T 11: 107,058,779 T2238K possibly damaging Het
Ccdc87 A G 19: 4,839,801 E107G probably benign Het
Ccng2 C T 5: 93,270,921 A135V probably benign Het
Chd8 C A 14: 52,204,109 R842L probably damaging Het
Cldn18 T A 9: 99,709,942 T3S probably benign Het
Dhcr7 T C 7: 143,836,731 probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dusp26 T C 8: 31,096,297 V182A probably damaging Het
Eif3e T C 15: 43,252,296 D358G possibly damaging Het
Epha3 A T 16: 63,568,443 L814H probably damaging Het
Flnc A G 6: 29,454,319 N1877S probably damaging Het
Fpgs A T 2: 32,687,941 Y156* probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm5591 T C 7: 38,521,895 D250G probably benign Het
Gtf2e2 C T 8: 33,776,015 R240* probably null Het
Hells G T 19: 38,954,810 Q519H probably benign Het
Hscb A G 5: 110,839,494 probably null Het
Inpp5k T A 11: 75,646,814 I350N probably damaging Het
Irf9 G A 14: 55,606,342 V221I possibly damaging Het
Itga8 A T 2: 12,253,469 Y261* probably null Het
Lama1 C T 17: 67,786,019 T1684M probably benign Het
Lrp2 A T 2: 69,438,467 H4157Q probably damaging Het
Nell2 A G 15: 95,385,144 F339S probably damaging Het
Olfr331 A T 11: 58,502,012 C181* probably null Het
Phf11a C A 14: 59,284,368 C118F probably damaging Het
Purg A G 8: 33,386,423 K30E possibly damaging Het
Qprt C T 7: 127,108,929 R110H probably damaging Het
Robo2 T C 16: 73,928,151 T1055A probably benign Het
Serpina3a T C 12: 104,112,878 F10L probably benign Het
Sidt1 A T 16: 44,300,935 probably null Het
Slc4a4 T A 5: 89,046,372 M237K probably benign Het
Slitrk5 A T 14: 111,680,252 D436V probably damaging Het
Snd1 T C 6: 28,888,289 Y908H probably damaging Het
Sorcs1 A G 19: 50,144,124 V1132A probably benign Het
Speer3 A G 5: 13,793,355 E92G probably damaging Het
Ssfa2 G A 2: 79,655,119 D506N probably damaging Het
Strada T C 11: 106,173,317 E58G possibly damaging Het
Tbx10 A T 19: 3,997,312 K139* probably null Het
Tcf4 T C 18: 69,633,580 Y25H probably damaging Het
Tmem108 C T 9: 103,499,761 R163H possibly damaging Het
Top2b A G 14: 16,399,026 T549A possibly damaging Het
Tpcn2 A G 7: 145,279,343 I46T probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vipr2 T A 12: 116,122,743 Y129* probably null Het
Vps37a A T 8: 40,540,708 Q248L probably benign Het
Wrap53 T C 11: 69,577,685 I179V probably benign Het
Zan G A 5: 137,452,488 A1609V unknown Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb5 G A 4: 44,993,459 R642W probably damaging Het
Zfyve27 A G 19: 42,182,657 probably null Het
Zufsp T C 10: 33,949,256 N77D probably benign Het
Other mutations in Nceh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Nceh1 APN 3 27241313 missense probably damaging 1.00
IGL02113:Nceh1 APN 3 27222891 missense probably damaging 1.00
cerdo UTSW 3 27241271 nonsense probably null
BB006:Nceh1 UTSW 3 27279247 missense probably benign 0.00
BB016:Nceh1 UTSW 3 27279247 missense probably benign 0.00
R0281:Nceh1 UTSW 3 27222804 missense possibly damaging 0.64
R0854:Nceh1 UTSW 3 27241319 missense probably damaging 1.00
R1562:Nceh1 UTSW 3 27239552 missense probably damaging 1.00
R1689:Nceh1 UTSW 3 27226082 missense probably damaging 0.99
R1918:Nceh1 UTSW 3 27183175 missense probably damaging 1.00
R2851:Nceh1 UTSW 3 27241355 missense probably damaging 1.00
R3959:Nceh1 UTSW 3 27279196 missense probably benign 0.01
R4420:Nceh1 UTSW 3 27241649 missense probably damaging 1.00
R4686:Nceh1 UTSW 3 27241669 missense probably damaging 1.00
R5165:Nceh1 UTSW 3 27241528 missense probably benign
R5243:Nceh1 UTSW 3 27241688 missense probably damaging 1.00
R5255:Nceh1 UTSW 3 27183139 missense probably damaging 0.96
R5598:Nceh1 UTSW 3 27226099 missense probably benign 0.01
R6076:Nceh1 UTSW 3 27279195 missense probably benign 0.00
R6729:Nceh1 UTSW 3 27241271 nonsense probably null
R6744:Nceh1 UTSW 3 27241789 missense probably damaging 1.00
R7618:Nceh1 UTSW 3 27183217 critical splice donor site probably null
R7749:Nceh1 UTSW 3 27207382 missense probably benign
R7929:Nceh1 UTSW 3 27279247 missense probably benign 0.00
R8040:Nceh1 UTSW 3 27241225 missense probably benign 0.00
R8350:Nceh1 UTSW 3 27239664 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCCTGCTGCTAACAGTTG -3'
(R):5'- AGACACTGACAATGTGGCCAG -3'

Sequencing Primer
(F):5'- GCTGCTAACAGTTGATCCCAC -3'
(R):5'- GCGACCTAGGAACCAGAATGTTC -3'
Posted On2018-04-27