Incidental Mutation 'R6337:Acsm5'
ID 513749
Institutional Source Beutler Lab
Gene Symbol Acsm5
Ensembl Gene ENSMUSG00000030972
Gene Name acyl-CoA synthetase medium-chain family member 5
Synonyms C730027J19Rik
MMRRC Submission 044491-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.235) question?
Stock # R6337 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 119125354-119142583 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 119133458 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 208 (A208T)
Ref Sequence ENSEMBL: ENSMUSP00000147176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066465] [ENSMUST00000207307] [ENSMUST00000207381] [ENSMUST00000207387] [ENSMUST00000207440] [ENSMUST00000207796] [ENSMUST00000207813]
AlphaFold Q8BGA8
Predicted Effect probably benign
Transcript: ENSMUST00000066465
AA Change: A208T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063416
Gene: ENSMUSG00000030972
AA Change: A208T

DomainStartEndE-ValueType
low complexity region 26 32 N/A INTRINSIC
Pfam:AMP-binding 65 477 2.9e-78 PFAM
Pfam:AMP-binding_C 485 565 3.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207307
AA Change: A208T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000207381
Predicted Effect probably benign
Transcript: ENSMUST00000207387
AA Change: A208T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207440
AA Change: A208T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207796
AA Change: A208T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000207813
AA Change: A208T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T G 3: 89,969,040 (GRCm39) V221G probably benign Het
Abca12 G A 1: 71,334,172 (GRCm39) A1110V probably damaging Het
Acsl6 C A 11: 54,231,368 (GRCm39) P462T probably damaging Het
Adcyap1 T A 17: 93,509,709 (GRCm39) Y53* probably null Het
Adgrg7 T A 16: 56,572,788 (GRCm39) I343F probably damaging Het
Agl T A 3: 116,580,426 (GRCm39) K376M possibly damaging Het
Akna A G 4: 63,292,240 (GRCm39) Y1142H probably benign Het
Anks1b A T 10: 90,757,158 (GRCm39) T182S probably benign Het
Apol7e T A 15: 77,598,582 (GRCm39) Y16N possibly damaging Het
Bptf G T 11: 106,949,605 (GRCm39) T2238K possibly damaging Het
Ccdc87 A G 19: 4,889,829 (GRCm39) E107G probably benign Het
Ccng2 C T 5: 93,418,780 (GRCm39) A135V probably benign Het
Chd8 C A 14: 52,441,566 (GRCm39) R842L probably damaging Het
Cldn18 T A 9: 99,591,995 (GRCm39) T3S probably benign Het
Dhcr7 T C 7: 143,390,468 (GRCm39) probably null Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Dusp26 T C 8: 31,586,325 (GRCm39) V182A probably damaging Het
Eif3e T C 15: 43,115,692 (GRCm39) D358G possibly damaging Het
Epha3 A T 16: 63,388,806 (GRCm39) L814H probably damaging Het
Flnc A G 6: 29,454,318 (GRCm39) N1877S probably damaging Het
Fpgs A T 2: 32,577,953 (GRCm39) Y156* probably null Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gm5591 T C 7: 38,221,319 (GRCm39) D250G probably benign Het
Gtf2e2 C T 8: 34,266,043 (GRCm39) R240* probably null Het
Hells G T 19: 38,943,254 (GRCm39) Q519H probably benign Het
Hscb A G 5: 110,987,360 (GRCm39) probably null Het
Inpp5k T A 11: 75,537,640 (GRCm39) I350N probably damaging Het
Irf9 G A 14: 55,843,799 (GRCm39) V221I possibly damaging Het
Itga8 A T 2: 12,258,280 (GRCm39) Y261* probably null Het
Itprid2 G A 2: 79,485,463 (GRCm39) D506N probably damaging Het
Lama1 C T 17: 68,093,014 (GRCm39) T1684M probably benign Het
Lrp2 A T 2: 69,268,811 (GRCm39) H4157Q probably damaging Het
Nceh1 G T 3: 27,276,956 (GRCm39) R93L probably damaging Het
Nell2 A G 15: 95,283,025 (GRCm39) F339S probably damaging Het
Or2t49 A T 11: 58,392,838 (GRCm39) C181* probably null Het
Phf11a C A 14: 59,521,817 (GRCm39) C118F probably damaging Het
Purg A G 8: 33,876,451 (GRCm39) K30E possibly damaging Het
Qprt C T 7: 126,708,101 (GRCm39) R110H probably damaging Het
Robo2 T C 16: 73,725,039 (GRCm39) T1055A probably benign Het
Serpina3a T C 12: 104,079,137 (GRCm39) F10L probably benign Het
Sidt1 A T 16: 44,121,298 (GRCm39) probably null Het
Slc4a4 T A 5: 89,194,231 (GRCm39) M237K probably benign Het
Slitrk5 A T 14: 111,917,684 (GRCm39) D436V probably damaging Het
Snd1 T C 6: 28,888,288 (GRCm39) Y908H probably damaging Het
Sorcs1 A G 19: 50,132,562 (GRCm39) V1132A probably benign Het
Speer3 A G 5: 13,843,369 (GRCm39) E92G probably damaging Het
Strada T C 11: 106,064,143 (GRCm39) E58G possibly damaging Het
Tbx10 A T 19: 4,047,312 (GRCm39) K139* probably null Het
Tcf4 T C 18: 69,766,651 (GRCm39) Y25H probably damaging Het
Tmem108 C T 9: 103,376,960 (GRCm39) R163H possibly damaging Het
Top2b A G 14: 16,399,026 (GRCm38) T549A possibly damaging Het
Tpcn2 A G 7: 144,833,080 (GRCm39) I46T probably damaging Het
Uox C T 3: 146,330,332 (GRCm39) R163* probably null Het
Vipr2 T A 12: 116,086,363 (GRCm39) Y129* probably null Het
Vps37a A T 8: 40,993,749 (GRCm39) Q248L probably benign Het
Wrap53 T C 11: 69,468,511 (GRCm39) I179V probably benign Het
Zan G A 5: 137,450,750 (GRCm39) A1609V unknown Het
Zbtb17 G A 4: 141,190,694 (GRCm39) G171S probably benign Het
Zbtb5 G A 4: 44,993,459 (GRCm39) R642W probably damaging Het
Zfyve27 A G 19: 42,171,096 (GRCm39) probably null Het
Zup1 T C 10: 33,825,252 (GRCm39) N77D probably benign Het
Other mutations in Acsm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Acsm5 APN 7 119,141,661 (GRCm39) critical splice donor site probably null
IGL01662:Acsm5 APN 7 119,137,511 (GRCm39) missense probably damaging 1.00
IGL02228:Acsm5 APN 7 119,131,089 (GRCm39) missense probably damaging 1.00
IGL02380:Acsm5 APN 7 119,136,509 (GRCm39) missense probably benign 0.05
IGL02709:Acsm5 APN 7 119,134,041 (GRCm39) nonsense probably null
P4717OSA:Acsm5 UTSW 7 119,131,195 (GRCm39) missense probably benign 0.12
R0506:Acsm5 UTSW 7 119,137,319 (GRCm39) nonsense probably null
R0518:Acsm5 UTSW 7 119,135,023 (GRCm39) missense possibly damaging 0.95
R0866:Acsm5 UTSW 7 119,140,123 (GRCm39) missense probably damaging 0.99
R1171:Acsm5 UTSW 7 119,140,075 (GRCm39) missense probably damaging 0.99
R2362:Acsm5 UTSW 7 119,127,649 (GRCm39) start gained probably benign
R2511:Acsm5 UTSW 7 119,129,677 (GRCm39) missense possibly damaging 0.80
R4670:Acsm5 UTSW 7 119,130,983 (GRCm39) splice site probably null
R4908:Acsm5 UTSW 7 119,137,314 (GRCm39) missense probably damaging 1.00
R4913:Acsm5 UTSW 7 119,133,566 (GRCm39) missense probably damaging 0.98
R5038:Acsm5 UTSW 7 119,134,034 (GRCm39) missense probably damaging 1.00
R5112:Acsm5 UTSW 7 119,136,502 (GRCm39) missense possibly damaging 0.95
R6481:Acsm5 UTSW 7 119,134,104 (GRCm39) missense probably benign 0.02
R7268:Acsm5 UTSW 7 119,136,511 (GRCm39) missense probably benign 0.38
R7275:Acsm5 UTSW 7 119,136,511 (GRCm39) missense possibly damaging 0.81
R7509:Acsm5 UTSW 7 119,133,611 (GRCm39) missense probably benign
R7794:Acsm5 UTSW 7 119,137,352 (GRCm39) unclassified probably benign
R8021:Acsm5 UTSW 7 119,141,616 (GRCm39) missense possibly damaging 0.72
R8178:Acsm5 UTSW 7 119,141,618 (GRCm39) missense probably damaging 1.00
R8797:Acsm5 UTSW 7 119,137,374 (GRCm39) missense probably damaging 1.00
Z1088:Acsm5 UTSW 7 119,136,434 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGCATTTCCTCAACTGAAACTC -3'
(R):5'- TTCAGACCTCCGAGACATACTC -3'

Sequencing Primer
(F):5'- CTGTGATAACTCCAGCTGTGTCAAG -3'
(R):5'- CGAGACATACTCTTCCAATACCTTC -3'
Posted On 2018-04-27