Incidental Mutation 'R6337:Dhcr7'
ID 513751
Institutional Source Beutler Lab
Gene Symbol Dhcr7
Ensembl Gene ENSMUSG00000058454
Gene Name 7-dehydrocholesterol reductase
Synonyms
MMRRC Submission 044491-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6337 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 143376882-143402147 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 143390468 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073878] [ENSMUST00000124340] [ENSMUST00000125564] [ENSMUST00000128454] [ENSMUST00000141916] [ENSMUST00000144034] [ENSMUST00000143338] [ENSMUST00000207143] [ENSMUST00000145471]
AlphaFold O88455
Predicted Effect probably null
Transcript: ENSMUST00000073878
SMART Domains Protein: ENSMUSP00000073541
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124340
SMART Domains Protein: ENSMUSP00000117659
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000125564
Predicted Effect probably benign
Transcript: ENSMUST00000128454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128610
Predicted Effect probably null
Transcript: ENSMUST00000141916
SMART Domains Protein: ENSMUSP00000121782
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000144034
SMART Domains Protein: ENSMUSP00000118957
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:ERG4_ERG24 75 225 1.3e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000143338
SMART Domains Protein: ENSMUSP00000119984
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000207143
Predicted Effect probably benign
Transcript: ENSMUST00000145471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208631
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that removes the C(7-8) double bond in the B ring of sterols and catalyzes the conversion of 7-dehydrocholesterol to cholesterol. This gene is ubiquitously expressed and its transmembrane protein localizes to the endoplasmic reticulum membrane and nuclear outer membrane. Mutations in this gene cause Smith-Lemli-Opitz syndrome (SLOS); a syndrome that is metabolically characterized by reduced serum cholesterol levels and elevated serum 7-dehydrocholesterol levels and phenotypically characterized by mental retardation, facial dysmorphism, syndactyly of second and third toes, and holoprosencephaly in severe cases to minimal physical abnormalities and near-normal intelligence in mild cases. Alternative splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene die within one day of birth due to respiratory and suckling problems. They exhibit abnormal cholesterol homeostasis with reduced tissue cholesterol levels and total sterol levels, enlarged bladders and sometimes cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T G 3: 89,969,040 (GRCm39) V221G probably benign Het
Abca12 G A 1: 71,334,172 (GRCm39) A1110V probably damaging Het
Acsl6 C A 11: 54,231,368 (GRCm39) P462T probably damaging Het
Acsm5 G A 7: 119,133,458 (GRCm39) A208T probably benign Het
Adcyap1 T A 17: 93,509,709 (GRCm39) Y53* probably null Het
Adgrg7 T A 16: 56,572,788 (GRCm39) I343F probably damaging Het
Agl T A 3: 116,580,426 (GRCm39) K376M possibly damaging Het
Akna A G 4: 63,292,240 (GRCm39) Y1142H probably benign Het
Anks1b A T 10: 90,757,158 (GRCm39) T182S probably benign Het
Apol7e T A 15: 77,598,582 (GRCm39) Y16N possibly damaging Het
Bptf G T 11: 106,949,605 (GRCm39) T2238K possibly damaging Het
Ccdc87 A G 19: 4,889,829 (GRCm39) E107G probably benign Het
Ccng2 C T 5: 93,418,780 (GRCm39) A135V probably benign Het
Chd8 C A 14: 52,441,566 (GRCm39) R842L probably damaging Het
Cldn18 T A 9: 99,591,995 (GRCm39) T3S probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Dusp26 T C 8: 31,586,325 (GRCm39) V182A probably damaging Het
Eif3e T C 15: 43,115,692 (GRCm39) D358G possibly damaging Het
Epha3 A T 16: 63,388,806 (GRCm39) L814H probably damaging Het
Flnc A G 6: 29,454,318 (GRCm39) N1877S probably damaging Het
Fpgs A T 2: 32,577,953 (GRCm39) Y156* probably null Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gm5591 T C 7: 38,221,319 (GRCm39) D250G probably benign Het
Gtf2e2 C T 8: 34,266,043 (GRCm39) R240* probably null Het
Hells G T 19: 38,943,254 (GRCm39) Q519H probably benign Het
Hscb A G 5: 110,987,360 (GRCm39) probably null Het
Inpp5k T A 11: 75,537,640 (GRCm39) I350N probably damaging Het
Irf9 G A 14: 55,843,799 (GRCm39) V221I possibly damaging Het
Itga8 A T 2: 12,258,280 (GRCm39) Y261* probably null Het
Itprid2 G A 2: 79,485,463 (GRCm39) D506N probably damaging Het
Lama1 C T 17: 68,093,014 (GRCm39) T1684M probably benign Het
Lrp2 A T 2: 69,268,811 (GRCm39) H4157Q probably damaging Het
Nceh1 G T 3: 27,276,956 (GRCm39) R93L probably damaging Het
Nell2 A G 15: 95,283,025 (GRCm39) F339S probably damaging Het
Or2t49 A T 11: 58,392,838 (GRCm39) C181* probably null Het
Phf11a C A 14: 59,521,817 (GRCm39) C118F probably damaging Het
Purg A G 8: 33,876,451 (GRCm39) K30E possibly damaging Het
Qprt C T 7: 126,708,101 (GRCm39) R110H probably damaging Het
Robo2 T C 16: 73,725,039 (GRCm39) T1055A probably benign Het
Serpina3a T C 12: 104,079,137 (GRCm39) F10L probably benign Het
Sidt1 A T 16: 44,121,298 (GRCm39) probably null Het
Slc4a4 T A 5: 89,194,231 (GRCm39) M237K probably benign Het
Slitrk5 A T 14: 111,917,684 (GRCm39) D436V probably damaging Het
Snd1 T C 6: 28,888,288 (GRCm39) Y908H probably damaging Het
Sorcs1 A G 19: 50,132,562 (GRCm39) V1132A probably benign Het
Speer3 A G 5: 13,843,369 (GRCm39) E92G probably damaging Het
Strada T C 11: 106,064,143 (GRCm39) E58G possibly damaging Het
Tbx10 A T 19: 4,047,312 (GRCm39) K139* probably null Het
Tcf4 T C 18: 69,766,651 (GRCm39) Y25H probably damaging Het
Tmem108 C T 9: 103,376,960 (GRCm39) R163H possibly damaging Het
Top2b A G 14: 16,399,026 (GRCm38) T549A possibly damaging Het
Tpcn2 A G 7: 144,833,080 (GRCm39) I46T probably damaging Het
Uox C T 3: 146,330,332 (GRCm39) R163* probably null Het
Vipr2 T A 12: 116,086,363 (GRCm39) Y129* probably null Het
Vps37a A T 8: 40,993,749 (GRCm39) Q248L probably benign Het
Wrap53 T C 11: 69,468,511 (GRCm39) I179V probably benign Het
Zan G A 5: 137,450,750 (GRCm39) A1609V unknown Het
Zbtb17 G A 4: 141,190,694 (GRCm39) G171S probably benign Het
Zbtb5 G A 4: 44,993,459 (GRCm39) R642W probably damaging Het
Zfyve27 A G 19: 42,171,096 (GRCm39) probably null Het
Zup1 T C 10: 33,825,252 (GRCm39) N77D probably benign Het
Other mutations in Dhcr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Dhcr7 APN 7 143,400,805 (GRCm39) missense probably damaging 0.99
IGL01398:Dhcr7 APN 7 143,395,056 (GRCm39) missense probably damaging 0.99
IGL01668:Dhcr7 APN 7 143,397,048 (GRCm39) missense probably damaging 1.00
IGL01822:Dhcr7 APN 7 143,399,236 (GRCm39) missense probably damaging 1.00
IGL02332:Dhcr7 APN 7 143,396,865 (GRCm39) missense probably damaging 1.00
IGL03136:Dhcr7 APN 7 143,401,103 (GRCm39) missense probably damaging 1.00
IGL03334:Dhcr7 APN 7 143,394,234 (GRCm39) missense possibly damaging 0.80
R0350:Dhcr7 UTSW 7 143,391,507 (GRCm39) missense probably damaging 1.00
R0433:Dhcr7 UTSW 7 143,394,200 (GRCm39) missense possibly damaging 0.92
R0834:Dhcr7 UTSW 7 143,394,964 (GRCm39) missense probably benign 0.19
R1473:Dhcr7 UTSW 7 143,400,805 (GRCm39) missense probably damaging 0.99
R1473:Dhcr7 UTSW 7 143,395,105 (GRCm39) missense probably damaging 1.00
R1769:Dhcr7 UTSW 7 143,401,250 (GRCm39) missense probably damaging 1.00
R1773:Dhcr7 UTSW 7 143,401,195 (GRCm39) missense possibly damaging 0.87
R1997:Dhcr7 UTSW 7 143,401,167 (GRCm39) missense probably damaging 0.99
R2302:Dhcr7 UTSW 7 143,391,629 (GRCm39) missense probably benign 0.00
R4177:Dhcr7 UTSW 7 143,394,910 (GRCm39) missense probably damaging 1.00
R4275:Dhcr7 UTSW 7 143,396,964 (GRCm39) missense probably damaging 1.00
R4829:Dhcr7 UTSW 7 143,391,654 (GRCm39) missense probably damaging 1.00
R4860:Dhcr7 UTSW 7 143,394,237 (GRCm39) missense probably benign 0.05
R4860:Dhcr7 UTSW 7 143,394,237 (GRCm39) missense probably benign 0.05
R4944:Dhcr7 UTSW 7 143,391,528 (GRCm39) missense probably damaging 0.96
R5000:Dhcr7 UTSW 7 143,395,060 (GRCm39) missense possibly damaging 0.94
R5454:Dhcr7 UTSW 7 143,391,576 (GRCm39) missense probably damaging 1.00
R5633:Dhcr7 UTSW 7 143,401,160 (GRCm39) missense probably damaging 0.99
R6683:Dhcr7 UTSW 7 143,397,048 (GRCm39) missense probably damaging 0.99
R7175:Dhcr7 UTSW 7 143,399,227 (GRCm39) missense probably damaging 1.00
R7785:Dhcr7 UTSW 7 143,399,209 (GRCm39) missense probably damaging 1.00
R8947:Dhcr7 UTSW 7 143,400,959 (GRCm39) missense probably damaging 1.00
R9006:Dhcr7 UTSW 7 143,394,978 (GRCm39) missense probably benign
R9052:Dhcr7 UTSW 7 143,395,060 (GRCm39) missense possibly damaging 0.79
R9629:Dhcr7 UTSW 7 143,401,212 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTCTCCCAGAATCTGTTGGG -3'
(R):5'- AGAGCACCCAAAATGGCTTC -3'

Sequencing Primer
(F):5'- AGCTACAAAGGTTGCCTGCTCTAG -3'
(R):5'- CCCAAAATGGCTTCTAAACTCTTC -3'
Posted On 2018-04-27