Incidental Mutation 'R6337:Cldn18'
ID513757
Institutional Source Beutler Lab
Gene Symbol Cldn18
Ensembl Gene ENSMUSG00000032473
Gene Nameclaudin 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6337 (G1)
Quality Score188.009
Status Validated
Chromosome9
Chromosomal Location99689461-99717267 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99709942 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 3 (T3S)
Ref Sequence ENSEMBL: ENSMUSP00000115782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035048] [ENSMUST00000112882] [ENSMUST00000131922] [ENSMUST00000136429]
Predicted Effect probably benign
Transcript: ENSMUST00000035048
AA Change: T3S

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000035048
Gene: ENSMUSG00000032473
AA Change: T3S

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 195 1e-28 PFAM
Pfam:Claudin_2 15 197 3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112882
SMART Domains Protein: ENSMUSP00000108503
Gene: ENSMUSG00000032473

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 195 4.2e-30 PFAM
Pfam:Claudin_2 15 197 4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131922
SMART Domains Protein: ENSMUSP00000117382
Gene: ENSMUSG00000032473

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 195 1.9e-30 PFAM
Pfam:Claudin_2 15 197 1.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136429
AA Change: T3S

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115782
Gene: ENSMUSG00000032473
AA Change: T3S

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 195 4e-29 PFAM
Pfam:Claudin_2 6 197 1e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161981
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is a downstream target gene regulated by the T/EBP/NKX2.1 homeodomain transcription factor. Four alternatively spliced transcript variants resulted from alternative promoters and alternative splicing have been identified, which encode two lung-specific isoforms and two stomach-specific isoforms respectively. This gene is also expressed in colons, inner ear and skin, and its expression is increased in both experimental colitis and ulcerative colitis. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased bone resorption and osteoclast differentiation. Homozygotes for another knock-out allele have impiared alveolarization and alveolar epithelial barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T G 3: 90,061,733 V221G probably benign Het
Abca12 G A 1: 71,295,013 A1110V probably damaging Het
Acsl6 C A 11: 54,340,542 P462T probably damaging Het
Acsm5 G A 7: 119,534,235 A208T probably benign Het
Adcyap1 T A 17: 93,202,281 Y53* probably null Het
Adgrg7 T A 16: 56,752,425 I343F probably damaging Het
Agl T A 3: 116,786,777 K376M possibly damaging Het
Akna A G 4: 63,374,003 Y1142H probably benign Het
Anks1b A T 10: 90,921,296 T182S probably benign Het
Apol7e T A 15: 77,714,382 Y16N possibly damaging Het
Bptf G T 11: 107,058,779 T2238K possibly damaging Het
Ccdc87 A G 19: 4,839,801 E107G probably benign Het
Ccng2 C T 5: 93,270,921 A135V probably benign Het
Chd8 C A 14: 52,204,109 R842L probably damaging Het
Dhcr7 T C 7: 143,836,731 probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dusp26 T C 8: 31,096,297 V182A probably damaging Het
Eif3e T C 15: 43,252,296 D358G possibly damaging Het
Epha3 A T 16: 63,568,443 L814H probably damaging Het
Flnc A G 6: 29,454,319 N1877S probably damaging Het
Fpgs A T 2: 32,687,941 Y156* probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm5591 T C 7: 38,521,895 D250G probably benign Het
Gtf2e2 C T 8: 33,776,015 R240* probably null Het
Hells G T 19: 38,954,810 Q519H probably benign Het
Hscb A G 5: 110,839,494 probably null Het
Inpp5k T A 11: 75,646,814 I350N probably damaging Het
Irf9 G A 14: 55,606,342 V221I possibly damaging Het
Itga8 A T 2: 12,253,469 Y261* probably null Het
Lama1 C T 17: 67,786,019 T1684M probably benign Het
Lrp2 A T 2: 69,438,467 H4157Q probably damaging Het
Nceh1 G T 3: 27,222,807 R93L probably damaging Het
Nell2 A G 15: 95,385,144 F339S probably damaging Het
Olfr331 A T 11: 58,502,012 C181* probably null Het
Phf11a C A 14: 59,284,368 C118F probably damaging Het
Purg A G 8: 33,386,423 K30E possibly damaging Het
Qprt C T 7: 127,108,929 R110H probably damaging Het
Robo2 T C 16: 73,928,151 T1055A probably benign Het
Serpina3a T C 12: 104,112,878 F10L probably benign Het
Sidt1 A T 16: 44,300,935 probably null Het
Slc4a4 T A 5: 89,046,372 M237K probably benign Het
Slitrk5 A T 14: 111,680,252 D436V probably damaging Het
Snd1 T C 6: 28,888,289 Y908H probably damaging Het
Sorcs1 A G 19: 50,144,124 V1132A probably benign Het
Speer3 A G 5: 13,793,355 E92G probably damaging Het
Ssfa2 G A 2: 79,655,119 D506N probably damaging Het
Strada T C 11: 106,173,317 E58G possibly damaging Het
Tbx10 A T 19: 3,997,312 K139* probably null Het
Tcf4 T C 18: 69,633,580 Y25H probably damaging Het
Tmem108 C T 9: 103,499,761 R163H possibly damaging Het
Top2b A G 14: 16,399,026 T549A possibly damaging Het
Tpcn2 A G 7: 145,279,343 I46T probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vipr2 T A 12: 116,122,743 Y129* probably null Het
Vps37a A T 8: 40,540,708 Q248L probably benign Het
Wrap53 T C 11: 69,577,685 I179V probably benign Het
Zan G A 5: 137,452,488 A1609V unknown Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb5 G A 4: 44,993,459 R642W probably damaging Het
Zfyve27 A G 19: 42,182,657 probably null Het
Zufsp T C 10: 33,949,256 N77D probably benign Het
Other mutations in Cldn18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Cldn18 APN 9 99698821 missense probably benign 0.29
IGL01317:Cldn18 APN 9 99696082 missense probably benign
IGL01804:Cldn18 APN 9 99698848 nonsense probably null
IGL02112:Cldn18 APN 9 99698075 missense probably benign 0.11
IGL02471:Cldn18 APN 9 99696075 missense probably benign 0.04
IGL02619:Cldn18 APN 9 99698935 missense probably damaging 0.97
R0313:Cldn18 UTSW 9 99698914 missense probably benign 0.00
R5384:Cldn18 UTSW 9 99709858 missense possibly damaging 0.93
R6419:Cldn18 UTSW 9 99692748 missense possibly damaging 0.65
Z1176:Cldn18 UTSW 9 99698847 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CAGGATGGTGAAGTATGGCC -3'
(R):5'- GCTGCTTCCCCAACAAATG -3'

Sequencing Primer
(F):5'- TGAAGTATGGCCGGCACTC -3'
(R):5'- ACCATGCCCTTGAAGCAGGAG -3'
Posted On2018-04-27