Incidental Mutation 'R6337:Zufsp'
ID 513759
Institutional Source Beutler Lab
Gene Symbol Zufsp
Ensembl Gene ENSMUSG00000039531
Gene Name zinc finger with UFM1-specific peptidase domain
Synonyms 2700019D07Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R6337 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 33919142-33951269 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 33949256 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 77 (N77D)
Ref Sequence ENSEMBL: ENSMUSP00000151477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048222] [ENSMUST00000218055] [ENSMUST00000218222] [ENSMUST00000218275] [ENSMUST00000218880] [ENSMUST00000218892] [ENSMUST00000219457] [ENSMUST00000219878]
AlphaFold Q3T9Z9
Predicted Effect probably benign
Transcript: ENSMUST00000048222
AA Change: N77D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037121
Gene: ENSMUSG00000039531
AA Change: N77D

DomainStartEndE-ValueType
ZnF_C2H2 2 24 5.42e-2 SMART
ZnF_C2H2 29 52 1.13e1 SMART
ZnF_C2H2 153 176 2.47e1 SMART
ZnF_C2H2 192 214 6.23e-2 SMART
coiled coil region 236 267 N/A INTRINSIC
Pfam:Peptidase_C78 334 550 1.2e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218055
AA Change: N77D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218222
AA Change: N77D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000218275
AA Change: N77D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218880
AA Change: N77D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218892
AA Change: N77D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000219457
AA Change: N77D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000219878
AA Change: N77D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T G 3: 90,061,733 V221G probably benign Het
Abca12 G A 1: 71,295,013 A1110V probably damaging Het
Acsl6 C A 11: 54,340,542 P462T probably damaging Het
Acsm5 G A 7: 119,534,235 A208T probably benign Het
Adcyap1 T A 17: 93,202,281 Y53* probably null Het
Adgrg7 T A 16: 56,752,425 I343F probably damaging Het
Agl T A 3: 116,786,777 K376M possibly damaging Het
Akna A G 4: 63,374,003 Y1142H probably benign Het
Anks1b A T 10: 90,921,296 T182S probably benign Het
Apol7e T A 15: 77,714,382 Y16N possibly damaging Het
Bptf G T 11: 107,058,779 T2238K possibly damaging Het
Ccdc87 A G 19: 4,839,801 E107G probably benign Het
Ccng2 C T 5: 93,270,921 A135V probably benign Het
Chd8 C A 14: 52,204,109 R842L probably damaging Het
Cldn18 T A 9: 99,709,942 T3S probably benign Het
Dhcr7 T C 7: 143,836,731 probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dusp26 T C 8: 31,096,297 V182A probably damaging Het
Eif3e T C 15: 43,252,296 D358G possibly damaging Het
Epha3 A T 16: 63,568,443 L814H probably damaging Het
Flnc A G 6: 29,454,319 N1877S probably damaging Het
Fpgs A T 2: 32,687,941 Y156* probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm5591 T C 7: 38,521,895 D250G probably benign Het
Gtf2e2 C T 8: 33,776,015 R240* probably null Het
Hells G T 19: 38,954,810 Q519H probably benign Het
Hscb A G 5: 110,839,494 probably null Het
Inpp5k T A 11: 75,646,814 I350N probably damaging Het
Irf9 G A 14: 55,606,342 V221I possibly damaging Het
Itga8 A T 2: 12,253,469 Y261* probably null Het
Lama1 C T 17: 67,786,019 T1684M probably benign Het
Lrp2 A T 2: 69,438,467 H4157Q probably damaging Het
Nceh1 G T 3: 27,222,807 R93L probably damaging Het
Nell2 A G 15: 95,385,144 F339S probably damaging Het
Olfr331 A T 11: 58,502,012 C181* probably null Het
Phf11a C A 14: 59,284,368 C118F probably damaging Het
Purg A G 8: 33,386,423 K30E possibly damaging Het
Qprt C T 7: 127,108,929 R110H probably damaging Het
Robo2 T C 16: 73,928,151 T1055A probably benign Het
Serpina3a T C 12: 104,112,878 F10L probably benign Het
Sidt1 A T 16: 44,300,935 probably null Het
Slc4a4 T A 5: 89,046,372 M237K probably benign Het
Slitrk5 A T 14: 111,680,252 D436V probably damaging Het
Snd1 T C 6: 28,888,289 Y908H probably damaging Het
Sorcs1 A G 19: 50,144,124 V1132A probably benign Het
Speer3 A G 5: 13,793,355 E92G probably damaging Het
Ssfa2 G A 2: 79,655,119 D506N probably damaging Het
Strada T C 11: 106,173,317 E58G possibly damaging Het
Tbx10 A T 19: 3,997,312 K139* probably null Het
Tcf4 T C 18: 69,633,580 Y25H probably damaging Het
Tmem108 C T 9: 103,499,761 R163H possibly damaging Het
Top2b A G 14: 16,399,026 T549A possibly damaging Het
Tpcn2 A G 7: 145,279,343 I46T probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vipr2 T A 12: 116,122,743 Y129* probably null Het
Vps37a A T 8: 40,540,708 Q248L probably benign Het
Wrap53 T C 11: 69,577,685 I179V probably benign Het
Zan G A 5: 137,452,488 A1609V unknown Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb5 G A 4: 44,993,459 R642W probably damaging Het
Zfyve27 A G 19: 42,182,657 probably null Het
Other mutations in Zufsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02510:Zufsp APN 10 33930154 critical splice donor site probably null
IGL02586:Zufsp APN 10 33935265 intron probably benign
IGL03350:Zufsp APN 10 33928111 missense probably benign 0.04
R0145:Zufsp UTSW 10 33943713 missense probably damaging 0.96
R1156:Zufsp UTSW 10 33949226 missense probably benign 0.15
R1523:Zufsp UTSW 10 33927440 missense probably damaging 1.00
R1769:Zufsp UTSW 10 33935176 missense probably damaging 1.00
R1802:Zufsp UTSW 10 33943718 missense probably damaging 0.98
R2013:Zufsp UTSW 10 33929824 missense possibly damaging 0.75
R2014:Zufsp UTSW 10 33929824 missense possibly damaging 0.75
R2015:Zufsp UTSW 10 33929824 missense possibly damaging 0.75
R2017:Zufsp UTSW 10 33927464 missense possibly damaging 0.46
R2342:Zufsp UTSW 10 33928117 missense probably damaging 1.00
R2901:Zufsp UTSW 10 33927612 missense probably damaging 1.00
R2901:Zufsp UTSW 10 33928063 missense probably benign
R3813:Zufsp UTSW 10 33940222 missense possibly damaging 0.63
R4488:Zufsp UTSW 10 33948964 missense probably damaging 1.00
R4674:Zufsp UTSW 10 33948984 missense possibly damaging 0.92
R4883:Zufsp UTSW 10 33949042 missense probably damaging 0.98
R4926:Zufsp UTSW 10 33949438 missense probably damaging 1.00
R5163:Zufsp UTSW 10 33949443 missense probably damaging 1.00
R5373:Zufsp UTSW 10 33927466 missense possibly damaging 0.46
R5374:Zufsp UTSW 10 33927466 missense possibly damaging 0.46
R5924:Zufsp UTSW 10 33927547 missense probably damaging 0.96
R5929:Zufsp UTSW 10 33949047 nonsense probably null
R5941:Zufsp UTSW 10 33949462 missense probably damaging 1.00
R6663:Zufsp UTSW 10 33949435 missense possibly damaging 0.86
R6753:Zufsp UTSW 10 33928029 missense probably damaging 1.00
R7690:Zufsp UTSW 10 33930155 critical splice donor site probably null
R7772:Zufsp UTSW 10 33921702 splice site probably null
R7836:Zufsp UTSW 10 33919319 missense unknown
R7919:Zufsp UTSW 10 33949112 missense possibly damaging 0.92
R8054:Zufsp UTSW 10 33940252 missense probably damaging 1.00
R8943:Zufsp UTSW 10 33919305 makesense probably null
R9433:Zufsp UTSW 10 33919359 missense probably damaging 1.00
X0063:Zufsp UTSW 10 33943687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGCCTCAGACAATCCAG -3'
(R):5'- TGTGGTGAAACTGTAAACTCAGAAC -3'

Sequencing Primer
(F):5'- GCCTCAGACAATCCAGGCTTC -3'
(R):5'- CCAGATATGAAAGCTCACCTAATTG -3'
Posted On 2018-04-27