Incidental Mutation 'R6337:Top2b'
ID513770
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Nametopoisomerase (DNA) II beta
SynonymsD230016L12Rik, Top-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R6337 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location16365179-16435462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16399026 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 549 (T549A)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017629
AA Change: T549A

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: T549A

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Meta Mutation Damage Score 0.1752 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T G 3: 90,061,733 V221G probably benign Het
Abca12 G A 1: 71,295,013 A1110V probably damaging Het
Acsl6 C A 11: 54,340,542 P462T probably damaging Het
Acsm5 G A 7: 119,534,235 A208T probably benign Het
Adcyap1 T A 17: 93,202,281 Y53* probably null Het
Adgrg7 T A 16: 56,752,425 I343F probably damaging Het
Agl T A 3: 116,786,777 K376M possibly damaging Het
Akna A G 4: 63,374,003 Y1142H probably benign Het
Anks1b A T 10: 90,921,296 T182S probably benign Het
Apol7e T A 15: 77,714,382 Y16N possibly damaging Het
Bptf G T 11: 107,058,779 T2238K possibly damaging Het
Ccdc87 A G 19: 4,839,801 E107G probably benign Het
Ccng2 C T 5: 93,270,921 A135V probably benign Het
Chd8 C A 14: 52,204,109 R842L probably damaging Het
Cldn18 T A 9: 99,709,942 T3S probably benign Het
Dhcr7 T C 7: 143,836,731 probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dusp26 T C 8: 31,096,297 V182A probably damaging Het
Eif3e T C 15: 43,252,296 D358G possibly damaging Het
Epha3 A T 16: 63,568,443 L814H probably damaging Het
Flnc A G 6: 29,454,319 N1877S probably damaging Het
Fpgs A T 2: 32,687,941 Y156* probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm5591 T C 7: 38,521,895 D250G probably benign Het
Gtf2e2 C T 8: 33,776,015 R240* probably null Het
Hells G T 19: 38,954,810 Q519H probably benign Het
Hscb A G 5: 110,839,494 probably null Het
Inpp5k T A 11: 75,646,814 I350N probably damaging Het
Irf9 G A 14: 55,606,342 V221I possibly damaging Het
Itga8 A T 2: 12,253,469 Y261* probably null Het
Lama1 C T 17: 67,786,019 T1684M probably benign Het
Lrp2 A T 2: 69,438,467 H4157Q probably damaging Het
Nceh1 G T 3: 27,222,807 R93L probably damaging Het
Nell2 A G 15: 95,385,144 F339S probably damaging Het
Olfr331 A T 11: 58,502,012 C181* probably null Het
Phf11a C A 14: 59,284,368 C118F probably damaging Het
Purg A G 8: 33,386,423 K30E possibly damaging Het
Qprt C T 7: 127,108,929 R110H probably damaging Het
Robo2 T C 16: 73,928,151 T1055A probably benign Het
Serpina3a T C 12: 104,112,878 F10L probably benign Het
Sidt1 A T 16: 44,300,935 probably null Het
Slc4a4 T A 5: 89,046,372 M237K probably benign Het
Slitrk5 A T 14: 111,680,252 D436V probably damaging Het
Snd1 T C 6: 28,888,289 Y908H probably damaging Het
Sorcs1 A G 19: 50,144,124 V1132A probably benign Het
Speer3 A G 5: 13,793,355 E92G probably damaging Het
Ssfa2 G A 2: 79,655,119 D506N probably damaging Het
Strada T C 11: 106,173,317 E58G possibly damaging Het
Tbx10 A T 19: 3,997,312 K139* probably null Het
Tcf4 T C 18: 69,633,580 Y25H probably damaging Het
Tmem108 C T 9: 103,499,761 R163H possibly damaging Het
Tpcn2 A G 7: 145,279,343 I46T probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vipr2 T A 12: 116,122,743 Y129* probably null Het
Vps37a A T 8: 40,540,708 Q248L probably benign Het
Wrap53 T C 11: 69,577,685 I179V probably benign Het
Zan G A 5: 137,452,488 A1609V unknown Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb5 G A 4: 44,993,459 R642W probably damaging Het
Zfyve27 A G 19: 42,182,657 probably null Het
Zufsp T C 10: 33,949,256 N77D probably benign Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16422692 missense probably benign 0.00
IGL00730:Top2b APN 14 16389831 missense probably damaging 1.00
IGL00917:Top2b APN 14 16407354 missense probably benign 0.05
IGL01959:Top2b APN 14 16422695 missense probably benign 0.19
IGL02019:Top2b APN 14 16409965 missense probably benign 0.44
IGL02119:Top2b APN 14 16406733 missense probably damaging 1.00
IGL02136:Top2b APN 14 16407103 unclassified probably benign
IGL02148:Top2b APN 14 16400488 missense probably damaging 1.00
IGL02496:Top2b APN 14 16387335 missense probably benign
IGL02503:Top2b APN 14 16407163 missense possibly damaging 0.92
IGL02672:Top2b APN 14 16409166 unclassified probably benign
IGL02721:Top2b APN 14 16409236 missense probably damaging 1.00
IGL02886:Top2b APN 14 16365688 missense possibly damaging 0.73
IGL03252:Top2b APN 14 16393163 missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16423780 critical splice donor site probably null
R0092:Top2b UTSW 14 16409263 missense probably damaging 1.00
R0201:Top2b UTSW 14 16383174 missense probably damaging 1.00
R0390:Top2b UTSW 14 16418442 missense probably benign 0.00
R0394:Top2b UTSW 14 16413556 splice site probably null
R1159:Top2b UTSW 14 16430329 missense possibly damaging 0.81
R1424:Top2b UTSW 14 16383177 missense probably damaging 1.00
R1519:Top2b UTSW 14 16408953 splice site probably null
R1561:Top2b UTSW 14 16398993 missense possibly damaging 0.80
R1713:Top2b UTSW 14 16409823 missense probably benign 0.05
R1987:Top2b UTSW 14 16398916 missense probably damaging 0.99
R2219:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2287:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2422:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2679:Top2b UTSW 14 16413947 missense probably damaging 1.00
R3687:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3707:Top2b UTSW 14 16388447 missense probably damaging 1.00
R3810:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3812:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3815:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3816:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3818:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4023:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4025:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4026:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4133:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4157:Top2b UTSW 14 16384491 missense probably benign 0.42
R4179:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4180:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4300:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4376:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4377:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4492:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4549:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4550:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4581:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4582:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4628:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4630:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4667:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4668:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4669:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4698:Top2b UTSW 14 16387331 nonsense probably null
R4769:Top2b UTSW 14 16398991 missense probably damaging 1.00
R4809:Top2b UTSW 14 16383125 missense probably benign 0.06
R4899:Top2b UTSW 14 16387313 missense probably damaging 1.00
R5035:Top2b UTSW 14 16409966 missense probably benign 0.01
R5621:Top2b UTSW 14 16387280 missense probably damaging 1.00
R5631:Top2b UTSW 14 16409882 missense probably damaging 1.00
R5685:Top2b UTSW 14 16413666 missense probably damaging 1.00
R5732:Top2b UTSW 14 16400106 missense possibly damaging 0.92
R5939:Top2b UTSW 14 16422786 missense probably damaging 0.96
R6007:Top2b UTSW 14 16423779 critical splice donor site probably null
R6087:Top2b UTSW 14 16409864 missense probably benign 0.14
R6144:Top2b UTSW 14 16423740 missense possibly damaging 0.48
R6196:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6218:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6229:Top2b UTSW 14 16409838 missense probably damaging 1.00
R6249:Top2b UTSW 14 16399006 missense probably damaging 1.00
R6353:Top2b UTSW 14 16416671 missense probably damaging 1.00
R6512:Top2b UTSW 14 16409854 missense possibly damaging 0.94
R6573:Top2b UTSW 14 16398991 missense probably damaging 1.00
R6614:Top2b UTSW 14 16407142 nonsense probably null
R6844:Top2b UTSW 14 16429383 missense possibly damaging 0.94
R6848:Top2b UTSW 14 16409958 missense possibly damaging 0.89
R6871:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6895:Top2b UTSW 14 16413604 missense probably benign 0.06
R7162:Top2b UTSW 14 16416653 missense probably benign 0.00
R7247:Top2b UTSW 14 16416962 missense probably benign 0.08
R7250:Top2b UTSW 14 16420411 missense probably benign
R7359:Top2b UTSW 14 16407376 missense probably null 1.00
R7365:Top2b UTSW 14 16416649 missense probably benign 0.04
R7493:Top2b UTSW 14 16416605 missense probably benign 0.00
R7528:Top2b UTSW 14 16395427 nonsense probably null
R7562:Top2b UTSW 14 16412946 missense probably benign 0.04
R7594:Top2b UTSW 14 16428587 missense probably benign
R7670:Top2b UTSW 14 16416620 missense possibly damaging 0.61
R7894:Top2b UTSW 14 16413081 missense possibly damaging 0.68
R8031:Top2b UTSW 14 16412986 missense probably damaging 0.98
R8150:Top2b UTSW 14 16393291 missense probably damaging 0.99
R8214:Top2b UTSW 14 16383177 missense probably damaging 1.00
R8299:Top2b UTSW 14 16386123 missense possibly damaging 0.68
X0028:Top2b UTSW 14 16384499 nonsense probably null
Z1176:Top2b UTSW 14 16395434 missense probably damaging 1.00
Z1177:Top2b UTSW 14 16416953 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGGAGTCTTCCCACTCAGG -3'
(R):5'- TATACTACTTCCCGAGACAATTACC -3'

Sequencing Primer
(F):5'- TTCTCAATGTACGAGAAGCCTC -3'
(R):5'- TTACCAAACAACAGTCTCAGAGTTAG -3'
Posted On2018-04-27