Incidental Mutation 'R6337:Eif3e'
ID513775
Institutional Source Beutler Lab
Gene Symbol Eif3e
Ensembl Gene ENSMUSG00000022336
Gene Nameeukaryotic translation initiation factor 3, subunit E
SynonymsEif3s6, eIF3-p46, 48kDa, Int6, eIF3-p48
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R6337 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location43250058-43282719 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43252296 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 358 (D358G)
Ref Sequence ENSEMBL: ENSMUSP00000022960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022960]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022960
AA Change: D358G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022960
Gene: ENSMUSG00000022336
AA Change: D358G

DomainStartEndE-ValueType
eIF3_N 5 138 4.88e-70 SMART
Blast:eIF3_N 157 193 2e-14 BLAST
Blast:PINT 218 251 7e-9 BLAST
Blast:PINT 284 315 3e-13 BLAST
PINT 327 411 8.17e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228892
Meta Mutation Damage Score 0.0963 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T G 3: 90,061,733 V221G probably benign Het
Abca12 G A 1: 71,295,013 A1110V probably damaging Het
Acsl6 C A 11: 54,340,542 P462T probably damaging Het
Acsm5 G A 7: 119,534,235 A208T probably benign Het
Adcyap1 T A 17: 93,202,281 Y53* probably null Het
Adgrg7 T A 16: 56,752,425 I343F probably damaging Het
Agl T A 3: 116,786,777 K376M possibly damaging Het
Akna A G 4: 63,374,003 Y1142H probably benign Het
Anks1b A T 10: 90,921,296 T182S probably benign Het
Apol7e T A 15: 77,714,382 Y16N possibly damaging Het
Bptf G T 11: 107,058,779 T2238K possibly damaging Het
Ccdc87 A G 19: 4,839,801 E107G probably benign Het
Ccng2 C T 5: 93,270,921 A135V probably benign Het
Chd8 C A 14: 52,204,109 R842L probably damaging Het
Cldn18 T A 9: 99,709,942 T3S probably benign Het
Dhcr7 T C 7: 143,836,731 probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dusp26 T C 8: 31,096,297 V182A probably damaging Het
Epha3 A T 16: 63,568,443 L814H probably damaging Het
Flnc A G 6: 29,454,319 N1877S probably damaging Het
Fpgs A T 2: 32,687,941 Y156* probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm5591 T C 7: 38,521,895 D250G probably benign Het
Gtf2e2 C T 8: 33,776,015 R240* probably null Het
Hells G T 19: 38,954,810 Q519H probably benign Het
Hscb A G 5: 110,839,494 probably null Het
Inpp5k T A 11: 75,646,814 I350N probably damaging Het
Irf9 G A 14: 55,606,342 V221I possibly damaging Het
Itga8 A T 2: 12,253,469 Y261* probably null Het
Lama1 C T 17: 67,786,019 T1684M probably benign Het
Lrp2 A T 2: 69,438,467 H4157Q probably damaging Het
Nceh1 G T 3: 27,222,807 R93L probably damaging Het
Nell2 A G 15: 95,385,144 F339S probably damaging Het
Olfr331 A T 11: 58,502,012 C181* probably null Het
Phf11a C A 14: 59,284,368 C118F probably damaging Het
Purg A G 8: 33,386,423 K30E possibly damaging Het
Qprt C T 7: 127,108,929 R110H probably damaging Het
Robo2 T C 16: 73,928,151 T1055A probably benign Het
Serpina3a T C 12: 104,112,878 F10L probably benign Het
Sidt1 A T 16: 44,300,935 probably null Het
Slc4a4 T A 5: 89,046,372 M237K probably benign Het
Slitrk5 A T 14: 111,680,252 D436V probably damaging Het
Snd1 T C 6: 28,888,289 Y908H probably damaging Het
Sorcs1 A G 19: 50,144,124 V1132A probably benign Het
Speer3 A G 5: 13,793,355 E92G probably damaging Het
Ssfa2 G A 2: 79,655,119 D506N probably damaging Het
Strada T C 11: 106,173,317 E58G possibly damaging Het
Tbx10 A T 19: 3,997,312 K139* probably null Het
Tcf4 T C 18: 69,633,580 Y25H probably damaging Het
Tmem108 C T 9: 103,499,761 R163H possibly damaging Het
Top2b A G 14: 16,399,026 T549A possibly damaging Het
Tpcn2 A G 7: 145,279,343 I46T probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vipr2 T A 12: 116,122,743 Y129* probably null Het
Vps37a A T 8: 40,540,708 Q248L probably benign Het
Wrap53 T C 11: 69,577,685 I179V probably benign Het
Zan G A 5: 137,452,488 A1609V unknown Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb5 G A 4: 44,993,459 R642W probably damaging Het
Zfyve27 A G 19: 42,182,657 probably null Het
Zufsp T C 10: 33,949,256 N77D probably benign Het
Other mutations in Eif3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Eif3e APN 15 43278349 missense probably benign 0.17
IGL02333:Eif3e APN 15 43266137 missense probably benign 0.37
IGL02669:Eif3e APN 15 43282692 start codon destroyed probably benign
IGL03119:Eif3e APN 15 43265604 missense probably benign
IGL03200:Eif3e APN 15 43252261 missense probably damaging 1.00
Verdugo UTSW 15 43272289 missense probably benign 0.29
R0152:Eif3e UTSW 15 43252236 missense possibly damaging 0.83
R1439:Eif3e UTSW 15 43278428 splice site probably benign
R1613:Eif3e UTSW 15 43250224 missense possibly damaging 0.81
R1997:Eif3e UTSW 15 43265609 missense probably damaging 1.00
R2221:Eif3e UTSW 15 43251547 missense possibly damaging 0.95
R3761:Eif3e UTSW 15 43261084 missense probably damaging 0.99
R4241:Eif3e UTSW 15 43262690 missense probably damaging 0.97
R4571:Eif3e UTSW 15 43266162 missense possibly damaging 0.74
R5061:Eif3e UTSW 15 43252261 missense probably damaging 1.00
R5227:Eif3e UTSW 15 43251521 missense probably benign 0.01
R5367:Eif3e UTSW 15 43252304 missense probably damaging 1.00
R5417:Eif3e UTSW 15 43265521 missense probably benign 0.00
R5497:Eif3e UTSW 15 43270970 missense probably damaging 0.98
R5928:Eif3e UTSW 15 43275332 splice site probably null
R6083:Eif3e UTSW 15 43266144 missense probably damaging 1.00
R6964:Eif3e UTSW 15 43272289 missense probably benign 0.29
R7692:Eif3e UTSW 15 43263246 missense probably damaging 0.98
R7825:Eif3e UTSW 15 43266271 splice site probably null
R8034:Eif3e UTSW 15 43272307 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCACCGTGAGATCATGTATCTATC -3'
(R):5'- GTCAAGGATCTTTACAGTCCAGC -3'

Sequencing Primer
(F):5'- CAGCATGTACCATACCAATA -3'
(R):5'- CAGTCCAGCTGGTATTATGAAGG -3'
Posted On2018-04-27