Incidental Mutation 'R6337:Epha3'
ID513780
Institutional Source Beutler Lab
Gene Symbol Epha3
Ensembl Gene ENSMUSG00000052504
Gene NameEph receptor A3
SynonymsTyro4, End3, Cek4, Hek, Hek4, Mek4
MMRRC Submission
Accession Numbers

Genbank: NM_010140; MGI: 99612

Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R6337 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location63543534-63864175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63568443 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 814 (L814H)
Ref Sequence ENSEMBL: ENSMUSP00000155946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064405] [ENSMUST00000232049]
Predicted Effect probably damaging
Transcript: ENSMUST00000064405
AA Change: L815H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066554
Gene: ENSMUSG00000052504
AA Change: L815H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EPH_lbd 29 202 1.76e-127 SMART
Pfam:GCC2_GCC3 263 306 6.6e-9 PFAM
FN3 326 418 1.14e-5 SMART
FN3 437 518 4.8e-13 SMART
Pfam:EphA2_TM 543 619 8.2e-25 PFAM
TyrKc 622 879 5.16e-140 SMART
SAM 909 976 1.08e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000232049
AA Change: L814H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 48 hours of birth of cardiac failure. Survivors develop normally with no indications of cardiac abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(2)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T G 3: 90,061,733 V221G probably benign Het
Abca12 G A 1: 71,295,013 A1110V probably damaging Het
Acsl6 C A 11: 54,340,542 P462T probably damaging Het
Acsm5 G A 7: 119,534,235 A208T probably benign Het
Adcyap1 T A 17: 93,202,281 Y53* probably null Het
Adgrg7 T A 16: 56,752,425 I343F probably damaging Het
Agl T A 3: 116,786,777 K376M possibly damaging Het
Akna A G 4: 63,374,003 Y1142H probably benign Het
Anks1b A T 10: 90,921,296 T182S probably benign Het
Apol7e T A 15: 77,714,382 Y16N possibly damaging Het
Bptf G T 11: 107,058,779 T2238K possibly damaging Het
Ccdc87 A G 19: 4,839,801 E107G probably benign Het
Ccng2 C T 5: 93,270,921 A135V probably benign Het
Chd8 C A 14: 52,204,109 R842L probably damaging Het
Cldn18 T A 9: 99,709,942 T3S probably benign Het
Dhcr7 T C 7: 143,836,731 probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dusp26 T C 8: 31,096,297 V182A probably damaging Het
Eif3e T C 15: 43,252,296 D358G possibly damaging Het
Flnc A G 6: 29,454,319 N1877S probably damaging Het
Fpgs A T 2: 32,687,941 Y156* probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm5591 T C 7: 38,521,895 D250G probably benign Het
Gtf2e2 C T 8: 33,776,015 R240* probably null Het
Hells G T 19: 38,954,810 Q519H probably benign Het
Hscb A G 5: 110,839,494 probably null Het
Inpp5k T A 11: 75,646,814 I350N probably damaging Het
Irf9 G A 14: 55,606,342 V221I possibly damaging Het
Itga8 A T 2: 12,253,469 Y261* probably null Het
Lama1 C T 17: 67,786,019 T1684M probably benign Het
Lrp2 A T 2: 69,438,467 H4157Q probably damaging Het
Nceh1 G T 3: 27,222,807 R93L probably damaging Het
Nell2 A G 15: 95,385,144 F339S probably damaging Het
Olfr331 A T 11: 58,502,012 C181* probably null Het
Phf11a C A 14: 59,284,368 C118F probably damaging Het
Purg A G 8: 33,386,423 K30E possibly damaging Het
Qprt C T 7: 127,108,929 R110H probably damaging Het
Robo2 T C 16: 73,928,151 T1055A probably benign Het
Serpina3a T C 12: 104,112,878 F10L probably benign Het
Sidt1 A T 16: 44,300,935 probably null Het
Slc4a4 T A 5: 89,046,372 M237K probably benign Het
Slitrk5 A T 14: 111,680,252 D436V probably damaging Het
Snd1 T C 6: 28,888,289 Y908H probably damaging Het
Sorcs1 A G 19: 50,144,124 V1132A probably benign Het
Speer3 A G 5: 13,793,355 E92G probably damaging Het
Ssfa2 G A 2: 79,655,119 D506N probably damaging Het
Strada T C 11: 106,173,317 E58G possibly damaging Het
Tbx10 A T 19: 3,997,312 K139* probably null Het
Tcf4 T C 18: 69,633,580 Y25H probably damaging Het
Tmem108 C T 9: 103,499,761 R163H possibly damaging Het
Top2b A G 14: 16,399,026 T549A possibly damaging Het
Tpcn2 A G 7: 145,279,343 I46T probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vipr2 T A 12: 116,122,743 Y129* probably null Het
Vps37a A T 8: 40,540,708 Q248L probably benign Het
Wrap53 T C 11: 69,577,685 I179V probably benign Het
Zan G A 5: 137,452,488 A1609V unknown Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb5 G A 4: 44,993,459 R642W probably damaging Het
Zfyve27 A G 19: 42,182,657 probably null Het
Zufsp T C 10: 33,949,256 N77D probably benign Het
Other mutations in Epha3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Epha3 APN 16 63566684 missense probably damaging 1.00
IGL01358:Epha3 APN 16 63595746 splice site probably benign
IGL01713:Epha3 APN 16 63552562 missense probably benign 0.00
IGL02371:Epha3 APN 16 63585020 critical splice acceptor site probably null
IGL03111:Epha3 APN 16 63653446 missense probably damaging 0.98
IGL03208:Epha3 APN 16 63611089 missense probably damaging 1.00
laterality UTSW 16 63568399 missense probably damaging 1.00
midline UTSW 16 63844144 missense possibly damaging 0.46
stride UTSW 16 63552494 missense probably benign 0.00
F2404:Epha3 UTSW 16 63546168 missense probably benign 0.14
P0041:Epha3 UTSW 16 63612868 missense probably damaging 1.00
PIT4498001:Epha3 UTSW 16 63552526 missense probably damaging 1.00
PIT4585001:Epha3 UTSW 16 63566577 critical splice donor site probably null
R0147:Epha3 UTSW 16 63612944 missense possibly damaging 0.89
R0148:Epha3 UTSW 16 63612944 missense possibly damaging 0.89
R0336:Epha3 UTSW 16 63566648 missense probably damaging 1.00
R0738:Epha3 UTSW 16 63595612 missense probably damaging 1.00
R0833:Epha3 UTSW 16 63603519 splice site probably benign
R0836:Epha3 UTSW 16 63603519 splice site probably benign
R0969:Epha3 UTSW 16 63566636 missense probably damaging 1.00
R1160:Epha3 UTSW 16 63773068 missense probably damaging 1.00
R1205:Epha3 UTSW 16 63598248 frame shift probably null
R1349:Epha3 UTSW 16 63611053 missense possibly damaging 0.89
R1372:Epha3 UTSW 16 63611053 missense possibly damaging 0.89
R1469:Epha3 UTSW 16 63653494 missense probably damaging 0.97
R1469:Epha3 UTSW 16 63653494 missense probably damaging 0.97
R1500:Epha3 UTSW 16 63595662 missense probably benign 0.06
R1523:Epha3 UTSW 16 63610948 missense probably damaging 0.99
R1532:Epha3 UTSW 16 63546178 missense probably benign 0.08
R1544:Epha3 UTSW 16 63773053 missense probably damaging 1.00
R1681:Epha3 UTSW 16 63595728 missense probably damaging 1.00
R1708:Epha3 UTSW 16 63583507 missense probably damaging 1.00
R1803:Epha3 UTSW 16 63602288 missense probably benign 0.00
R1893:Epha3 UTSW 16 63568399 missense probably damaging 1.00
R1957:Epha3 UTSW 16 63772952 missense probably benign 0.00
R2144:Epha3 UTSW 16 63773317 missense possibly damaging 0.86
R2190:Epha3 UTSW 16 63546189 missense probably benign 0.05
R2198:Epha3 UTSW 16 63844144 missense possibly damaging 0.46
R2344:Epha3 UTSW 16 63652383 missense possibly damaging 0.67
R2504:Epha3 UTSW 16 63603625 missense probably damaging 0.97
R2911:Epha3 UTSW 16 63652412 missense probably benign
R3889:Epha3 UTSW 16 63610964 missense probably damaging 1.00
R4223:Epha3 UTSW 16 63583539 missense probably damaging 0.99
R4836:Epha3 UTSW 16 63583557 missense probably damaging 1.00
R4981:Epha3 UTSW 16 63652412 missense probably benign 0.04
R5044:Epha3 UTSW 16 63602287 missense possibly damaging 0.79
R5195:Epha3 UTSW 16 63546147 missense possibly damaging 0.86
R5248:Epha3 UTSW 16 63598257 missense probably damaging 1.00
R5478:Epha3 UTSW 16 63583533 missense probably damaging 1.00
R6052:Epha3 UTSW 16 63603604 missense possibly damaging 0.94
R6167:Epha3 UTSW 16 63612924 missense probably benign 0.00
R6342:Epha3 UTSW 16 63583500 missense probably damaging 1.00
R6793:Epha3 UTSW 16 63773455 missense probably benign 0.01
R6908:Epha3 UTSW 16 63598249 missense probably damaging 1.00
R7029:Epha3 UTSW 16 63773335 missense probably benign 0.37
R7059:Epha3 UTSW 16 63568455 missense probably damaging 1.00
R7175:Epha3 UTSW 16 63583500 missense probably damaging 1.00
R7204:Epha3 UTSW 16 63652332 missense probably benign
R7217:Epha3 UTSW 16 63552494 missense probably benign 0.00
R7315:Epha3 UTSW 16 63552609 missense probably benign 0.00
R7389:Epha3 UTSW 16 63772984 missense probably damaging 1.00
R7419:Epha3 UTSW 16 63598294 missense probably damaging 1.00
R7572:Epha3 UTSW 16 63611080 nonsense probably null
R7667:Epha3 UTSW 16 63566600 missense probably benign 0.21
R7686:Epha3 UTSW 16 63773288 missense probably damaging 1.00
R7855:Epha3 UTSW 16 63773560 missense probably damaging 1.00
R7938:Epha3 UTSW 16 63773560 missense probably damaging 1.00
Z1176:Epha3 UTSW 16 63585012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCGTGCTTGAGGGAAATAAG -3'
(R):5'- TCCTTCAGAGCAGATACCCTG -3'

Sequencing Primer
(F):5'- ATTCGTCTAAGTATTCAGCTCCGATG -3'
(R):5'- TCAGAGCAGATACCCTGAAAAATTG -3'
Posted On2018-04-27