Incidental Mutation 'R6339:4931408C20Rik'
ID513793
Institutional Source Beutler Lab
Gene Symbol 4931408C20Rik
Ensembl Gene ENSMUSG00000073722
Gene NameRIKEN cDNA 4931408C20 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6339 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location26681814-26687460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26682505 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1198 (D1198V)
Ref Sequence ENSEMBL: ENSMUSP00000095410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097801]
Predicted Effect probably benign
Transcript: ENSMUST00000097801
AA Change: D1198V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000095410
Gene: ENSMUSG00000073722
AA Change: D1198V

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:FAM75 128 474 4.6e-28 PFAM
internal_repeat_1 939 1112 4.27e-16 PROSPERO
internal_repeat_1 1204 1376 4.27e-16 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 97% (69/71)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933424G06Rik A T 1: 36,710,461 probably benign Het
Adgrg6 G T 10: 14,434,347 S743R probably damaging Het
Ak8 A G 2: 28,734,448 probably null Het
Alpk2 A G 18: 65,349,806 M377T probably benign Het
Ap1g1 G A 8: 109,844,368 V425I possibly damaging Het
Apob A T 12: 8,016,188 R4353W probably damaging Het
Arhgef38 T C 3: 133,133,662 K540R probably benign Het
AY761184 G A 8: 21,703,469 S45F possibly damaging Het
B3galt2 A T 1: 143,646,902 T259S possibly damaging Het
Btbd8 G A 5: 107,503,717 V159I probably benign Het
C2cd2l T C 9: 44,313,491 probably benign Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Ccdc171 A T 4: 83,742,997 T1115S probably damaging Het
Chst2 C T 9: 95,405,750 G181D probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Cpt1a A C 19: 3,362,152 D208A probably benign Het
Crocc2 A G 1: 93,214,032 E1183G probably benign Het
Dlg5 T A 14: 24,158,060 H1003L probably damaging Het
Dok2 A T 14: 70,775,718 I109L probably benign Het
Dpy19l4 A T 4: 11,285,111 I465K probably damaging Het
Dync1h1 A T 12: 110,646,205 D2838V probably damaging Het
Frem3 A G 8: 80,613,015 R646G possibly damaging Het
Gcfc2 T A 6: 81,946,496 F514I probably damaging Het
Gm8104 T C 14: 43,101,485 M44T probably benign Het
Golph3l T A 3: 95,617,439 W334R probably damaging Het
Gpr179 A T 11: 97,344,176 F443I probably damaging Het
Ift172 A G 5: 31,256,583 V1467A probably benign Het
Ift172 A T 5: 31,286,945 D44E probably damaging Het
Il1rl1 C T 1: 40,461,856 A464V possibly damaging Het
Irx5 A G 8: 92,359,853 E188G probably damaging Het
Jak1 A G 4: 101,161,926 V710A probably damaging Het
Kcng4 A T 8: 119,632,954 F228I probably damaging Het
Lifr A G 15: 7,167,049 N238S probably benign Het
Ltbp3 C A 19: 5,747,477 H414Q probably damaging Het
Mcpt8 A G 14: 56,082,337 C219R probably benign Het
Mepce A T 5: 137,785,688 N125K possibly damaging Het
Mfap3 T C 11: 57,529,772 F193S probably damaging Het
Miox T A 15: 89,335,499 Y63* probably null Het
Msl2 A T 9: 101,101,750 H441L probably benign Het
Nemp2 T A 1: 52,640,910 S98T possibly damaging Het
Neto2 G T 8: 85,640,558 A547E probably benign Het
Nol12 T C 15: 78,940,833 probably benign Het
Npr3 T C 15: 11,845,275 I504V probably damaging Het
Olfr1204 A G 2: 88,852,871 D307G probably null Het
Pcdhb3 T C 18: 37,300,945 probably benign Het
Pear1 C A 3: 87,752,520 G720W probably damaging Het
Pibf1 T G 14: 99,107,398 D151E probably damaging Het
Pla2g6 T A 15: 79,308,816 N217I probably damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Plcl1 C T 1: 55,696,315 L272F probably damaging Het
Ppp4r4 A T 12: 103,604,969 K656* probably null Het
Prr22 G A 17: 56,771,490 M214I probably benign Het
Ror1 G T 4: 100,411,931 R322L possibly damaging Het
Sh3tc2 G A 18: 61,975,571 W244* probably null Het
Slamf6 A G 1: 171,948,048 N320S probably null Het
Slc1a6 A C 10: 78,800,085 D328A possibly damaging Het
Sorl1 G T 9: 41,969,742 T2161K probably benign Het
Sstr2 T C 11: 113,624,549 F98S probably damaging Het
Stk33 A T 7: 109,321,465 D348E probably benign Het
Sulf1 T A 1: 12,838,440 L559Q probably damaging Het
Syne2 A G 12: 75,989,153 D3738G probably benign Het
Taok3 A T 5: 117,228,030 Q382L probably benign Het
Tet2 T A 3: 133,486,417 H752L possibly damaging Het
Tia1 A C 6: 86,426,656 K285T probably damaging Het
Tle3 G T 9: 61,401,924 probably null Het
Top1mt T C 15: 75,665,656 T414A possibly damaging Het
Ubc A T 5: 125,387,342 I307N probably damaging Het
Vmn2r96 A T 17: 18,583,862 D266V possibly damaging Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zfp456 T A 13: 67,362,364 K102* probably null Het
Zkscan1 T C 5: 138,093,305 V100A probably damaging Het
Other mutations in 4931408C20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:4931408C20Rik APN 1 26684977 missense probably benign 0.00
IGL00575:4931408C20Rik APN 1 26682932 missense possibly damaging 0.51
IGL00656:4931408C20Rik APN 1 26682901 missense possibly damaging 0.71
IGL00671:4931408C20Rik APN 1 26684859 missense possibly damaging 0.50
IGL00777:4931408C20Rik APN 1 26682092 missense probably damaging 1.00
IGL00824:4931408C20Rik APN 1 26683589 missense possibly damaging 0.48
IGL01018:4931408C20Rik APN 1 26682910 missense probably damaging 0.99
IGL01148:4931408C20Rik APN 1 26685172 missense probably benign 0.22
IGL01631:4931408C20Rik APN 1 26685414 missense probably damaging 0.98
IGL01901:4931408C20Rik APN 1 26682584 missense probably benign 0.13
IGL01957:4931408C20Rik APN 1 26685259 missense probably damaging 0.98
IGL02031:4931408C20Rik APN 1 26685023 missense probably damaging 0.99
IGL02596:4931408C20Rik APN 1 26684002 missense probably benign 0.00
PIT4486001:4931408C20Rik UTSW 1 26685329 missense probably damaging 0.99
R0026:4931408C20Rik UTSW 1 26683369 missense probably benign 0.00
R0026:4931408C20Rik UTSW 1 26683369 missense probably benign 0.00
R0043:4931408C20Rik UTSW 1 26683802 missense possibly damaging 0.72
R0141:4931408C20Rik UTSW 1 26683782 missense probably benign 0.00
R0145:4931408C20Rik UTSW 1 26687332 missense probably benign 0.00
R0158:4931408C20Rik UTSW 1 26683951 missense probably damaging 0.98
R0325:4931408C20Rik UTSW 1 26685266 missense possibly damaging 0.91
R0627:4931408C20Rik UTSW 1 26685889 missense probably benign 0.00
R0733:4931408C20Rik UTSW 1 26682932 missense possibly damaging 0.51
R1033:4931408C20Rik UTSW 1 26682385 missense probably benign
R1074:4931408C20Rik UTSW 1 26683226 missense probably benign 0.00
R1108:4931408C20Rik UTSW 1 26682466 missense possibly damaging 0.85
R1139:4931408C20Rik UTSW 1 26682665 missense probably benign 0.04
R1326:4931408C20Rik UTSW 1 26683930 missense probably damaging 1.00
R1398:4931408C20Rik UTSW 1 26685341 missense possibly damaging 0.82
R1422:4931408C20Rik UTSW 1 26682466 missense possibly damaging 0.85
R1463:4931408C20Rik UTSW 1 26682141 nonsense probably null
R1485:4931408C20Rik UTSW 1 26685880 missense possibly damaging 0.92
R1568:4931408C20Rik UTSW 1 26685869 missense probably benign 0.01
R1603:4931408C20Rik UTSW 1 26685569 missense probably damaging 0.99
R1605:4931408C20Rik UTSW 1 26684430 missense possibly damaging 0.92
R1795:4931408C20Rik UTSW 1 26682989 nonsense probably null
R1945:4931408C20Rik UTSW 1 26682314 missense probably benign 0.04
R1967:4931408C20Rik UTSW 1 26683373 missense probably benign 0.02
R2055:4931408C20Rik UTSW 1 26685732 missense possibly damaging 0.86
R2093:4931408C20Rik UTSW 1 26682141 nonsense probably null
R2131:4931408C20Rik UTSW 1 26685854 missense probably benign 0.11
R2237:4931408C20Rik UTSW 1 26685160 missense possibly damaging 0.82
R2314:4931408C20Rik UTSW 1 26684702 missense probably benign 0.00
R2407:4931408C20Rik UTSW 1 26682838 missense possibly damaging 0.86
R2993:4931408C20Rik UTSW 1 26685828 missense possibly damaging 0.83
R4245:4931408C20Rik UTSW 1 26682080 missense probably benign 0.00
R4567:4931408C20Rik UTSW 1 26683117 missense probably benign
R4605:4931408C20Rik UTSW 1 26683186 missense probably benign 0.45
R4708:4931408C20Rik UTSW 1 26684440 missense possibly damaging 0.92
R4827:4931408C20Rik UTSW 1 26685842 missense possibly damaging 0.91
R4839:4931408C20Rik UTSW 1 26685359 missense probably benign 0.11
R4888:4931408C20Rik UTSW 1 26683547 missense probably benign 0.00
R5075:4931408C20Rik UTSW 1 26683052 missense probably damaging 0.99
R5101:4931408C20Rik UTSW 1 26683336 missense possibly damaging 0.92
R5231:4931408C20Rik UTSW 1 26683951 missense possibly damaging 0.79
R5310:4931408C20Rik UTSW 1 26685088 missense probably benign 0.00
R5459:4931408C20Rik UTSW 1 26685191 missense probably damaging 0.96
R5520:4931408C20Rik UTSW 1 26685819 missense probably benign 0.00
R5608:4931408C20Rik UTSW 1 26683048 missense probably damaging 0.97
R5960:4931408C20Rik UTSW 1 26683144 missense probably benign 0.34
R6128:4931408C20Rik UTSW 1 26685425 missense probably benign 0.38
R6188:4931408C20Rik UTSW 1 26685703 missense probably damaging 0.99
R6319:4931408C20Rik UTSW 1 26685401 missense probably benign 0.38
R6431:4931408C20Rik UTSW 1 26684030 missense probably benign 0.11
R6456:4931408C20Rik UTSW 1 26685169 missense probably damaging 0.99
R6562:4931408C20Rik UTSW 1 26682362 missense possibly damaging 0.91
R6645:4931408C20Rik UTSW 1 26683117 missense probably benign 0.06
R6647:4931408C20Rik UTSW 1 26682578 missense probably damaging 0.99
R6919:4931408C20Rik UTSW 1 26682934 missense probably benign 0.15
R7085:4931408C20Rik UTSW 1 26683465 missense possibly damaging 0.95
R7183:4931408C20Rik UTSW 1 26682833 missense probably benign 0.27
R7347:4931408C20Rik UTSW 1 26684467 missense probably benign 0.02
R7488:4931408C20Rik UTSW 1 26683958 missense possibly damaging 0.77
R7565:4931408C20Rik UTSW 1 26685270 missense probably benign 0.00
X0025:4931408C20Rik UTSW 1 26682505 missense probably benign 0.00
X0061:4931408C20Rik UTSW 1 26682569 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CGTGGTCAAAGCCTCTTCTC -3'
(R):5'- TCCACATATAAGCCCTGAGATG -3'

Sequencing Primer
(F):5'- GTGGTCAAAGCCTCTTCTCTTCAC -3'
(R):5'- TGAGATGCATAACCATTCACTCAG -3'
Posted On2018-04-27