Incidental Mutation 'R6339:Arhgef38'
ID513804
Institutional Source Beutler Lab
Gene Symbol Arhgef38
Ensembl Gene ENSMUSG00000040969
Gene NameRho guanine nucleotide exchange factor (GEF) 38
SynonymsD630013G24Rik, 9130221D24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6339 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location133112278-133234949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133133662 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 540 (K540R)
Ref Sequence ENSEMBL: ENSMUSP00000114238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054105] [ENSMUST00000147041]
Predicted Effect probably benign
Transcript: ENSMUST00000054105
SMART Domains Protein: ENSMUSP00000054558
Gene: ENSMUSG00000040969

DomainStartEndE-ValueType
SH3 1 60 5.56e-1 SMART
low complexity region 95 106 N/A INTRINSIC
SH3 126 189 8.2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147041
AA Change: K540R

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114238
Gene: ENSMUSG00000040969
AA Change: K540R

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
RhoGEF 98 284 2.72e-33 SMART
low complexity region 296 312 N/A INTRINSIC
BAR 315 514 4.8e-29 SMART
SH3 584 643 5.56e-1 SMART
low complexity region 678 689 N/A INTRINSIC
SH3 709 768 1.95e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 97% (69/71)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,505 D1198V probably benign Het
4933424G06Rik A T 1: 36,710,461 probably benign Het
Adgrg6 G T 10: 14,434,347 S743R probably damaging Het
Ak8 A G 2: 28,734,448 probably null Het
Alpk2 A G 18: 65,349,806 M377T probably benign Het
Ap1g1 G A 8: 109,844,368 V425I possibly damaging Het
Apob A T 12: 8,016,188 R4353W probably damaging Het
AY761184 G A 8: 21,703,469 S45F possibly damaging Het
B3galt2 A T 1: 143,646,902 T259S possibly damaging Het
Btbd8 G A 5: 107,503,717 V159I probably benign Het
C2cd2l T C 9: 44,313,491 probably benign Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Ccdc171 A T 4: 83,742,997 T1115S probably damaging Het
Chst2 C T 9: 95,405,750 G181D probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Cpt1a A C 19: 3,362,152 D208A probably benign Het
Crocc2 A G 1: 93,214,032 E1183G probably benign Het
Dlg5 T A 14: 24,158,060 H1003L probably damaging Het
Dok2 A T 14: 70,775,718 I109L probably benign Het
Dpy19l4 A T 4: 11,285,111 I465K probably damaging Het
Dync1h1 A T 12: 110,646,205 D2838V probably damaging Het
Frem3 A G 8: 80,613,015 R646G possibly damaging Het
Gcfc2 T A 6: 81,946,496 F514I probably damaging Het
Gm8104 T C 14: 43,101,485 M44T probably benign Het
Golph3l T A 3: 95,617,439 W334R probably damaging Het
Gpr179 A T 11: 97,344,176 F443I probably damaging Het
Ift172 A G 5: 31,256,583 V1467A probably benign Het
Ift172 A T 5: 31,286,945 D44E probably damaging Het
Il1rl1 C T 1: 40,461,856 A464V possibly damaging Het
Irx5 A G 8: 92,359,853 E188G probably damaging Het
Jak1 A G 4: 101,161,926 V710A probably damaging Het
Kcng4 A T 8: 119,632,954 F228I probably damaging Het
Lifr A G 15: 7,167,049 N238S probably benign Het
Ltbp3 C A 19: 5,747,477 H414Q probably damaging Het
Mcpt8 A G 14: 56,082,337 C219R probably benign Het
Mepce A T 5: 137,785,688 N125K possibly damaging Het
Mfap3 T C 11: 57,529,772 F193S probably damaging Het
Miox T A 15: 89,335,499 Y63* probably null Het
Msl2 A T 9: 101,101,750 H441L probably benign Het
Nemp2 T A 1: 52,640,910 S98T possibly damaging Het
Neto2 G T 8: 85,640,558 A547E probably benign Het
Nol12 T C 15: 78,940,833 probably benign Het
Npr3 T C 15: 11,845,275 I504V probably damaging Het
Olfr1204 A G 2: 88,852,871 D307G probably null Het
Pcdhb3 T C 18: 37,300,945 probably benign Het
Pear1 C A 3: 87,752,520 G720W probably damaging Het
Pibf1 T G 14: 99,107,398 D151E probably damaging Het
Pla2g6 T A 15: 79,308,816 N217I probably damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Plcl1 C T 1: 55,696,315 L272F probably damaging Het
Ppp4r4 A T 12: 103,604,969 K656* probably null Het
Prr22 G A 17: 56,771,490 M214I probably benign Het
Ror1 G T 4: 100,411,931 R322L possibly damaging Het
Sh3tc2 G A 18: 61,975,571 W244* probably null Het
Slamf6 A G 1: 171,948,048 N320S probably null Het
Slc1a6 A C 10: 78,800,085 D328A possibly damaging Het
Sorl1 G T 9: 41,969,742 T2161K probably benign Het
Sstr2 T C 11: 113,624,549 F98S probably damaging Het
Stk33 A T 7: 109,321,465 D348E probably benign Het
Sulf1 T A 1: 12,838,440 L559Q probably damaging Het
Syne2 A G 12: 75,989,153 D3738G probably benign Het
Taok3 A T 5: 117,228,030 Q382L probably benign Het
Tet2 T A 3: 133,486,417 H752L possibly damaging Het
Tia1 A C 6: 86,426,656 K285T probably damaging Het
Tle3 G T 9: 61,401,924 probably null Het
Top1mt T C 15: 75,665,656 T414A possibly damaging Het
Ubc A T 5: 125,387,342 I307N probably damaging Het
Vmn2r96 A T 17: 18,583,862 D266V possibly damaging Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zfp456 T A 13: 67,362,364 K102* probably null Het
Zkscan1 T C 5: 138,093,305 V100A probably damaging Het
Other mutations in Arhgef38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Arhgef38 APN 3 133132051 missense probably benign 0.05
IGL00533:Arhgef38 APN 3 133116459 nonsense probably null
IGL03031:Arhgef38 APN 3 133132067 missense possibly damaging 0.90
F5770:Arhgef38 UTSW 3 133149540 missense probably damaging 1.00
PIT4362001:Arhgef38 UTSW 3 133160830 missense
R0050:Arhgef38 UTSW 3 133132196 missense probably damaging 0.99
R0050:Arhgef38 UTSW 3 133132196 missense probably damaging 0.99
R0076:Arhgef38 UTSW 3 133160746 missense possibly damaging 0.52
R0515:Arhgef38 UTSW 3 133149540 missense probably damaging 1.00
R0730:Arhgef38 UTSW 3 133137471 missense probably benign 0.25
R0765:Arhgef38 UTSW 3 133116583 missense probably damaging 1.00
R1054:Arhgef38 UTSW 3 133116465 missense probably damaging 1.00
R1261:Arhgef38 UTSW 3 133160863 missense possibly damaging 0.52
R1568:Arhgef38 UTSW 3 133132464 missense probably damaging 0.98
R1580:Arhgef38 UTSW 3 133133704 missense probably benign 0.24
R1716:Arhgef38 UTSW 3 133140837 missense probably benign 0.35
R1875:Arhgef38 UTSW 3 133133740 critical splice acceptor site probably null
R2118:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2119:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2122:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2417:Arhgef38 UTSW 3 133146473 missense probably damaging 1.00
R3832:Arhgef38 UTSW 3 133206925 missense possibly damaging 0.89
R4657:Arhgef38 UTSW 3 133234681 missense probably damaging 1.00
R4666:Arhgef38 UTSW 3 133140772 critical splice donor site probably null
R4732:Arhgef38 UTSW 3 133132269 nonsense probably null
R4733:Arhgef38 UTSW 3 133132269 nonsense probably null
R5059:Arhgef38 UTSW 3 133137414 missense probably damaging 1.00
R5108:Arhgef38 UTSW 3 133137268 missense probably benign 0.14
R5310:Arhgef38 UTSW 3 133116466 missense probably damaging 0.98
R5820:Arhgef38 UTSW 3 133160799 missense probably benign 0.44
R5987:Arhgef38 UTSW 3 133206958 missense possibly damaging 0.67
R6115:Arhgef38 UTSW 3 133132613 intron probably null
R6313:Arhgef38 UTSW 3 133234708 missense possibly damaging 0.80
R6356:Arhgef38 UTSW 3 133140877 missense probably benign 0.01
R6648:Arhgef38 UTSW 3 133132475 missense probably damaging 1.00
R7050:Arhgef38 UTSW 3 133133627 start gained probably benign
R7083:Arhgef38 UTSW 3 133132436 missense unknown
R7561:Arhgef38 UTSW 3 133160728 missense
Predicted Primers PCR Primer
(F):5'- GCGTGTAATTTACATGGTGCAG -3'
(R):5'- AGAAATTTACTCCCGGCTCTGTC -3'

Sequencing Primer
(F):5'- GACAGTACAGGGATCCATGTGCTAC -3'
(R):5'- CTAGAAGCTATGGAGTTGCCC -3'
Posted On2018-04-27