Incidental Mutation 'R6339:Sstr2'
ID 513837
Institutional Source Beutler Lab
Gene Symbol Sstr2
Ensembl Gene ENSMUSG00000047904
Gene Name somatostatin receptor 2
Synonyms SSTR-2, Smstr2, Smstr-2, sst2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.716) question?
Stock # R6339 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 113619342-113626028 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113624549 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 98 (F98S)
Ref Sequence ENSEMBL: ENSMUSP00000138101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067591] [ENSMUST00000106630] [ENSMUST00000125890] [ENSMUST00000136392] [ENSMUST00000146031] [ENSMUST00000146390]
AlphaFold P30875
Predicted Effect probably damaging
Transcript: ENSMUST00000067591
AA Change: F98S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068578
Gene: ENSMUSG00000047904
AA Change: F98S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 51 281 1.1e-10 PFAM
Pfam:7TM_GPCR_Srsx 54 327 1.9e-20 PFAM
Pfam:7tm_1 60 312 2.5e-70 PFAM
Pfam:7TM_GPCR_Srv 118 329 4.9e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106630
AA Change: F98S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102241
Gene: ENSMUSG00000047904
AA Change: F98S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 51 284 1.3e-10 PFAM
Pfam:7TM_GPCR_Srsx 54 327 1.9e-20 PFAM
Pfam:7tm_1 60 312 1.4e-65 PFAM
Pfam:7TM_GPCR_Srv 119 328 4.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123153
Predicted Effect probably benign
Transcript: ENSMUST00000125890
SMART Domains Protein: ENSMUSP00000115472
Gene: ENSMUSG00000041654

DomainStartEndE-ValueType
Pfam:Zip 7 200 3.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136392
Predicted Effect probably benign
Transcript: ENSMUST00000146031
SMART Domains Protein: ENSMUSP00000121286
Gene: ENSMUSG00000041654

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146390
AA Change: F98S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138101
Gene: ENSMUSG00000047904
AA Change: F98S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 51 284 1.8e-10 PFAM
Pfam:7TM_GPCR_Srsx 54 327 2.4e-20 PFAM
Pfam:7tm_1 60 312 3.1e-70 PFAM
Pfam:7TM_GPCR_Srv 118 329 5.7e-13 PFAM
Meta Mutation Damage Score 0.9503 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: The protein encoded by this gene is a receptor for somatostatin, which acts at many sites to inhibit the release of several hormones and other secretory proteins. The encoded protein is a member of the superfamily of receptors having seven transmembrane segments and is involved in many processes, including adenylyl cyclase inhibition, phosphotyrosine phosphatase stimulation, and inhibition of calcium entry and cell growth. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a null allele show elevated anxiety and locomotor and exploratory deficits. Homozygotes for a reporter allele show altered motor coordination, somatostatin-induced dopamine and glutamate release, retinal rod bipolar cells and EEG patterns, and reduced infarction after focal ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,505 D1198V probably benign Het
4933424G06Rik A T 1: 36,710,461 probably benign Het
Adgrg6 G T 10: 14,434,347 S743R probably damaging Het
Ak8 A G 2: 28,734,448 probably null Het
Alpk2 A G 18: 65,349,806 M377T probably benign Het
Ap1g1 G A 8: 109,844,368 V425I possibly damaging Het
Apob A T 12: 8,016,188 R4353W probably damaging Het
Arhgef38 T C 3: 133,133,662 K540R probably benign Het
AY761184 G A 8: 21,703,469 S45F possibly damaging Het
B3galt2 A T 1: 143,646,902 T259S possibly damaging Het
Btbd8 G A 5: 107,503,717 V159I probably benign Het
C2cd2l T C 9: 44,313,491 probably benign Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Ccdc171 A T 4: 83,742,997 T1115S probably damaging Het
Chst2 C T 9: 95,405,750 G181D probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Cpt1a A C 19: 3,362,152 D208A probably benign Het
Crocc2 A G 1: 93,214,032 E1183G probably benign Het
Dlg5 T A 14: 24,158,060 H1003L probably damaging Het
Dok2 A T 14: 70,775,718 I109L probably benign Het
Dpy19l4 A T 4: 11,285,111 I465K probably damaging Het
Dync1h1 A T 12: 110,646,205 D2838V probably damaging Het
Frem3 A G 8: 80,613,015 R646G possibly damaging Het
Gcfc2 T A 6: 81,946,496 F514I probably damaging Het
Gm8104 T C 14: 43,101,485 M44T probably benign Het
Golph3l T A 3: 95,617,439 W334R probably damaging Het
Gpr179 A T 11: 97,344,176 F443I probably damaging Het
Ift172 A G 5: 31,256,583 V1467A probably benign Het
Ift172 A T 5: 31,286,945 D44E probably damaging Het
Il1rl1 C T 1: 40,461,856 A464V possibly damaging Het
Irx5 A G 8: 92,359,853 E188G probably damaging Het
Jak1 A G 4: 101,161,926 V710A probably damaging Het
Kcng4 A T 8: 119,632,954 F228I probably damaging Het
Lifr A G 15: 7,167,049 N238S probably benign Het
Ltbp3 C A 19: 5,747,477 H414Q probably damaging Het
Mcpt8 A G 14: 56,082,337 C219R probably benign Het
Mepce A T 5: 137,785,688 N125K possibly damaging Het
Mfap3 T C 11: 57,529,772 F193S probably damaging Het
Miox T A 15: 89,335,499 Y63* probably null Het
Msl2 A T 9: 101,101,750 H441L probably benign Het
Nemp2 T A 1: 52,640,910 S98T possibly damaging Het
Neto2 G T 8: 85,640,558 A547E probably benign Het
Nol12 T C 15: 78,940,833 probably benign Het
Npr3 T C 15: 11,845,275 I504V probably damaging Het
Olfr1204 A G 2: 88,852,871 D307G probably null Het
Pcdhb3 T C 18: 37,300,945 probably benign Het
Pear1 C A 3: 87,752,520 G720W probably damaging Het
Pibf1 T G 14: 99,107,398 D151E probably damaging Het
Pla2g6 T A 15: 79,308,816 N217I probably damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Plcl1 C T 1: 55,696,315 L272F probably damaging Het
Ppp4r4 A T 12: 103,604,969 K656* probably null Het
Prr22 G A 17: 56,771,490 M214I probably benign Het
Ror1 G T 4: 100,411,931 R322L possibly damaging Het
Sh3tc2 G A 18: 61,975,571 W244* probably null Het
Slamf6 A G 1: 171,948,048 N320S probably null Het
Slc1a6 A C 10: 78,800,085 D328A possibly damaging Het
Sorl1 G T 9: 41,969,742 T2161K probably benign Het
Stk33 A T 7: 109,321,465 D348E probably benign Het
Sulf1 T A 1: 12,838,440 L559Q probably damaging Het
Syne2 A G 12: 75,989,153 D3738G probably benign Het
Taok3 A T 5: 117,228,030 Q382L probably benign Het
Tet2 T A 3: 133,486,417 H752L possibly damaging Het
Tia1 A C 6: 86,426,656 K285T probably damaging Het
Tle3 G T 9: 61,401,924 probably null Het
Top1mt T C 15: 75,665,656 T414A possibly damaging Het
Ubc A T 5: 125,387,342 I307N probably damaging Het
Vmn2r96 A T 17: 18,583,862 D266V possibly damaging Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zfp456 T A 13: 67,362,364 K102* probably null Het
Zkscan1 T C 5: 138,093,305 V100A probably damaging Het
Other mutations in Sstr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Sstr2 APN 11 113624995 missense probably benign 0.22
IGL01555:Sstr2 APN 11 113625619 missense probably benign 0.32
IGL02173:Sstr2 APN 11 113625016 missense probably damaging 1.00
IGL02430:Sstr2 APN 11 113624804 missense probably damaging 0.99
chat UTSW 11 113624549 missense probably damaging 1.00
R0125:Sstr2 UTSW 11 113624477 missense probably damaging 1.00
R0565:Sstr2 UTSW 11 113625619 missense probably benign 0.32
R1227:Sstr2 UTSW 11 113624885 missense probably damaging 0.99
R1356:Sstr2 UTSW 11 113624894 missense probably damaging 1.00
R1992:Sstr2 UTSW 11 113624669 missense probably benign 0.03
R2504:Sstr2 UTSW 11 113624431 missense probably damaging 0.98
R2509:Sstr2 UTSW 11 113624923 missense probably damaging 0.99
R2510:Sstr2 UTSW 11 113624923 missense probably damaging 0.99
R2511:Sstr2 UTSW 11 113624923 missense probably damaging 0.99
R4051:Sstr2 UTSW 11 113624656 missense probably damaging 1.00
R4083:Sstr2 UTSW 11 113625245 missense probably benign 0.05
R4207:Sstr2 UTSW 11 113624656 missense probably damaging 1.00
R4208:Sstr2 UTSW 11 113624656 missense probably damaging 1.00
R5666:Sstr2 UTSW 11 113624713 missense probably damaging 1.00
R6264:Sstr2 UTSW 11 113625106 missense probably damaging 1.00
R6443:Sstr2 UTSW 11 113625254 splice site probably null
R6968:Sstr2 UTSW 11 113624948 missense probably damaging 1.00
R7146:Sstr2 UTSW 11 113625353 missense probably damaging 1.00
R7735:Sstr2 UTSW 11 113624597 missense possibly damaging 0.75
R8057:Sstr2 UTSW 11 113624273 missense probably benign
R8086:Sstr2 UTSW 11 113625172 missense probably damaging 1.00
R8087:Sstr2 UTSW 11 113624675 missense probably damaging 1.00
R9076:Sstr2 UTSW 11 113624351 missense probably benign 0.00
R9194:Sstr2 UTSW 11 113624377 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGACCTCAACGGCTCACTG -3'
(R):5'- CCTCCATTTGGCTGACTTAATG -3'

Sequencing Primer
(F):5'- TCACTGGGGCCAAGCAATG -3'
(R):5'- TGACTTAATGGGGTGCACCAC -3'
Posted On 2018-04-27