Incidental Mutation 'R6339:Pla2g6'
ID513853
Institutional Source Beutler Lab
Gene Symbol Pla2g6
Ensembl Gene ENSMUSG00000042632
Gene Namephospholipase A2, group VI
SynonymsiPLA2beta, iPLA2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6339 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location79286228-79328390 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79308816 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 217 (N217I)
Ref Sequence ENSEMBL: ENSMUSP00000134672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047816] [ENSMUST00000166977] [ENSMUST00000172403] [ENSMUST00000173109] [ENSMUST00000173163] [ENSMUST00000173632] [ENSMUST00000174021]
Predicted Effect probably damaging
Transcript: ENSMUST00000047816
AA Change: N217I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044234
Gene: ENSMUSG00000042632
AA Change: N217I

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166977
AA Change: N217I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132071
Gene: ENSMUSG00000042632
AA Change: N217I

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172403
AA Change: N217I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131081
Gene: ENSMUSG00000042632
AA Change: N217I

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173109
SMART Domains Protein: ENSMUSP00000133554
Gene: ENSMUSG00000042632

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173163
AA Change: N217I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134456
Gene: ENSMUSG00000042632
AA Change: N217I

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173601
Predicted Effect probably benign
Transcript: ENSMUST00000173632
SMART Domains Protein: ENSMUSP00000133998
Gene: ENSMUSG00000042632

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
Blast:ANK 185 204 7e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000174021
AA Change: N217I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134672
Gene: ENSMUSG00000042632
AA Change: N217I

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Blast:ANK 382 411 2e-8 BLAST
Pfam:Patatin 482 666 2.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174375
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an A2 phospholipase, a class of enzyme that catalyzes the release of fatty acids from phospholipids. The encoded protein may play a role in phospholipid remodelling, arachidonic acid release, leukotriene and prostaglandin synthesis, fas-mediated apoptosis, and transmembrane ion flux in glucose-stimulated B-cells. Several transcript variants encoding multiple isoforms have been described, but the full-length nature of only three of them have been determined to date. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mice display impaired male fertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,505 D1198V probably benign Het
4933424G06Rik A T 1: 36,710,461 probably benign Het
Adgrg6 G T 10: 14,434,347 S743R probably damaging Het
Ak8 A G 2: 28,734,448 probably null Het
Alpk2 A G 18: 65,349,806 M377T probably benign Het
Ap1g1 G A 8: 109,844,368 V425I possibly damaging Het
Apob A T 12: 8,016,188 R4353W probably damaging Het
Arhgef38 T C 3: 133,133,662 K540R probably benign Het
AY761184 G A 8: 21,703,469 S45F possibly damaging Het
B3galt2 A T 1: 143,646,902 T259S possibly damaging Het
Btbd8 G A 5: 107,503,717 V159I probably benign Het
C2cd2l T C 9: 44,313,491 probably benign Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Ccdc171 A T 4: 83,742,997 T1115S probably damaging Het
Chst2 C T 9: 95,405,750 G181D probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Cpt1a A C 19: 3,362,152 D208A probably benign Het
Crocc2 A G 1: 93,214,032 E1183G probably benign Het
Dlg5 T A 14: 24,158,060 H1003L probably damaging Het
Dok2 A T 14: 70,775,718 I109L probably benign Het
Dpy19l4 A T 4: 11,285,111 I465K probably damaging Het
Dync1h1 A T 12: 110,646,205 D2838V probably damaging Het
Frem3 A G 8: 80,613,015 R646G possibly damaging Het
Gcfc2 T A 6: 81,946,496 F514I probably damaging Het
Gm8104 T C 14: 43,101,485 M44T probably benign Het
Golph3l T A 3: 95,617,439 W334R probably damaging Het
Gpr179 A T 11: 97,344,176 F443I probably damaging Het
Ift172 A G 5: 31,256,583 V1467A probably benign Het
Ift172 A T 5: 31,286,945 D44E probably damaging Het
Il1rl1 C T 1: 40,461,856 A464V possibly damaging Het
Irx5 A G 8: 92,359,853 E188G probably damaging Het
Jak1 A G 4: 101,161,926 V710A probably damaging Het
Kcng4 A T 8: 119,632,954 F228I probably damaging Het
Lifr A G 15: 7,167,049 N238S probably benign Het
Ltbp3 C A 19: 5,747,477 H414Q probably damaging Het
Mcpt8 A G 14: 56,082,337 C219R probably benign Het
Mepce A T 5: 137,785,688 N125K possibly damaging Het
Mfap3 T C 11: 57,529,772 F193S probably damaging Het
Miox T A 15: 89,335,499 Y63* probably null Het
Msl2 A T 9: 101,101,750 H441L probably benign Het
Nemp2 T A 1: 52,640,910 S98T possibly damaging Het
Neto2 G T 8: 85,640,558 A547E probably benign Het
Nol12 T C 15: 78,940,833 probably benign Het
Npr3 T C 15: 11,845,275 I504V probably damaging Het
Olfr1204 A G 2: 88,852,871 D307G probably null Het
Pcdhb3 T C 18: 37,300,945 probably benign Het
Pear1 C A 3: 87,752,520 G720W probably damaging Het
Pibf1 T G 14: 99,107,398 D151E probably damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Plcl1 C T 1: 55,696,315 L272F probably damaging Het
Ppp4r4 A T 12: 103,604,969 K656* probably null Het
Prr22 G A 17: 56,771,490 M214I probably benign Het
Ror1 G T 4: 100,411,931 R322L possibly damaging Het
Sh3tc2 G A 18: 61,975,571 W244* probably null Het
Slamf6 A G 1: 171,948,048 N320S probably null Het
Slc1a6 A C 10: 78,800,085 D328A possibly damaging Het
Sorl1 G T 9: 41,969,742 T2161K probably benign Het
Sstr2 T C 11: 113,624,549 F98S probably damaging Het
Stk33 A T 7: 109,321,465 D348E probably benign Het
Sulf1 T A 1: 12,838,440 L559Q probably damaging Het
Syne2 A G 12: 75,989,153 D3738G probably benign Het
Taok3 A T 5: 117,228,030 Q382L probably benign Het
Tet2 T A 3: 133,486,417 H752L possibly damaging Het
Tia1 A C 6: 86,426,656 K285T probably damaging Het
Tle3 G T 9: 61,401,924 probably null Het
Top1mt T C 15: 75,665,656 T414A possibly damaging Het
Ubc A T 5: 125,387,342 I307N probably damaging Het
Vmn2r96 A T 17: 18,583,862 D266V possibly damaging Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zfp456 T A 13: 67,362,364 K102* probably null Het
Zkscan1 T C 5: 138,093,305 V100A probably damaging Het
Other mutations in Pla2g6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Pla2g6 APN 15 79289241 missense probably damaging 0.96
IGL00906:Pla2g6 APN 15 79287747 missense probably damaging 1.00
IGL01432:Pla2g6 APN 15 79317968 start codon destroyed probably null 1.00
IGL01640:Pla2g6 APN 15 79304313 missense probably benign
IGL01715:Pla2g6 APN 15 79317857 missense probably benign 0.00
IGL01943:Pla2g6 APN 15 79313116 missense probably null 0.00
IGL02551:Pla2g6 APN 15 79299094 missense possibly damaging 0.95
IGL03120:Pla2g6 APN 15 79286860 missense probably damaging 1.00
IGL03193:Pla2g6 APN 15 79317785 missense probably damaging 0.98
IGL03194:Pla2g6 APN 15 79317785 missense probably damaging 0.98
IGL03205:Pla2g6 APN 15 79317785 missense probably damaging 0.98
IGL03289:Pla2g6 APN 15 79317785 missense probably damaging 0.98
R0288:Pla2g6 UTSW 15 79286906 splice site probably benign
R0631:Pla2g6 UTSW 15 79306396 missense probably damaging 1.00
R1216:Pla2g6 UTSW 15 79306435 missense probably benign 0.18
R1617:Pla2g6 UTSW 15 79289141 missense probably benign 0.03
R1785:Pla2g6 UTSW 15 79306345 missense probably benign 0.02
R2025:Pla2g6 UTSW 15 79286764 missense probably damaging 1.00
R2079:Pla2g6 UTSW 15 79312994 missense probably damaging 1.00
R3952:Pla2g6 UTSW 15 79313096 missense probably damaging 1.00
R4774:Pla2g6 UTSW 15 79287618 missense probably damaging 1.00
R4826:Pla2g6 UTSW 15 79308679 missense possibly damaging 0.96
R5093:Pla2g6 UTSW 15 79287128 missense probably benign 0.12
R5327:Pla2g6 UTSW 15 79302637 missense probably benign 0.03
R5390:Pla2g6 UTSW 15 79289693 missense possibly damaging 0.72
R5419:Pla2g6 UTSW 15 79299142 missense possibly damaging 0.82
R5432:Pla2g6 UTSW 15 79302617 critical splice donor site probably null
R5633:Pla2g6 UTSW 15 79299142 missense possibly damaging 0.82
R5829:Pla2g6 UTSW 15 79287693 missense possibly damaging 0.73
R5930:Pla2g6 UTSW 15 79303528 intron probably benign
R6228:Pla2g6 UTSW 15 79305724 missense probably benign 0.00
R6241:Pla2g6 UTSW 15 79304392 missense probably benign 0.02
R6485:Pla2g6 UTSW 15 79307372 missense probably benign 0.00
R6754:Pla2g6 UTSW 15 79306310 missense probably benign 0.01
R7419:Pla2g6 UTSW 15 79305698 splice site probably null
R7425:Pla2g6 UTSW 15 79308733 missense probably damaging 1.00
R7710:Pla2g6 UTSW 15 79287158 missense probably damaging 0.98
R7738:Pla2g6 UTSW 15 79297433 nonsense probably null
R7768:Pla2g6 UTSW 15 79297314 missense probably damaging 1.00
R7796:Pla2g6 UTSW 15 79317825 missense probably benign 0.32
R8184:Pla2g6 UTSW 15 79287122 missense probably benign 0.02
R8359:Pla2g6 UTSW 15 79287170 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACACTTGGTGTGAAGCCACC -3'
(R):5'- CTGGTCAGCCATTCTTACAATC -3'

Sequencing Primer
(F):5'- TTGGTGTGAAGCCACCACATAAC -3'
(R):5'- GTCAGCCATTCTTACAATCTCCAGAG -3'
Posted On2018-04-27