Mutagenetix > Incidental Mutation

Incidental Mutation 'R6339:Pla2g6'

513853

Institutional Source

Beutler Lab

Gene Symbol

Pla2g6

Ensembl Gene

ENSMUSG00000042632

Gene Name

phospholipase A2, group VI

Synonyms

iPLA2beta, iPLA2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6339 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79286228-79328390 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79308816 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 217 (N217I)

Ref Sequence

ENSEMBL: ENSMUSP00000134672 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047816] [ENSMUST00000166977] [ENSMUST00000172403] [ENSMUST00000173109] [ENSMUST00000173163] [ENSMUST00000173632] [ENSMUST00000174021]

AlphaFold

P97819

Predicted Effect

probably damaging
Transcript: ENSMUST00000047816
AA Change: N217I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000044234
Gene: ENSMUSG00000042632
AA Change: N217I

Domain	Start	End	E-Value	Type
low complexity region	96	109	N/A	INTRINSIC
ANK	151	181	2.97e-3	SMART
ANK	185	215	4.6e0	SMART
ANK	219	248	3.23e-4	SMART
ANK	286	312	1.52e0	SMART
ANK	316	345	6.46e-4	SMART
ANK	349	378	2.02e-5	SMART
Pfam:Patatin	427	611	6.7e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000166977
AA Change: N217I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000132071
Gene: ENSMUSG00000042632
AA Change: N217I

Domain	Start	End	E-Value	Type
low complexity region	96	109	N/A	INTRINSIC
ANK	151	181	2.97e-3	SMART
ANK	185	215	4.6e0	SMART
ANK	219	248	3.23e-4	SMART
ANK	286	312	1.52e0	SMART
ANK	316	345	6.46e-4	SMART
ANK	349	378	2.02e-5	SMART
Pfam:Patatin	427	611	6.7e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000172403
AA Change: N217I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000131081
Gene: ENSMUSG00000042632
AA Change: N217I

Domain	Start	End	E-Value	Type
low complexity region	96	109	N/A	INTRINSIC
ANK	151	181	2.97e-3	SMART
ANK	185	215	4.6e0	SMART
ANK	219	248	3.23e-4	SMART
ANK	286	312	1.52e0	SMART
ANK	316	345	6.46e-4	SMART
ANK	349	378	2.02e-5	SMART
Pfam:Patatin	427	611	6.7e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173109

SMART Domains

Protein: ENSMUSP00000133554
Gene: ENSMUSG00000042632

Domain	Start	End	E-Value	Type
low complexity region	96	109	N/A	INTRINSIC
ANK	151	181	2.97e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000173163
AA Change: N217I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000134456
Gene: ENSMUSG00000042632
AA Change: N217I

Domain	Start	End	E-Value	Type
low complexity region	96	109	N/A	INTRINSIC
ANK	151	181	2.97e-3	SMART
ANK	185	215	4.6e0	SMART
ANK	219	248	3.23e-4	SMART
ANK	286	312	1.52e0	SMART
ANK	316	345	6.46e-4	SMART
ANK	349	378	2.02e-5	SMART
Pfam:Patatin	427	611	6.7e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173412

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173601

Predicted Effect

probably benign
Transcript: ENSMUST00000173632

SMART Domains

Protein: ENSMUSP00000133998
Gene: ENSMUSG00000042632

Domain	Start	End	E-Value	Type
low complexity region	96	109	N/A	INTRINSIC
ANK	151	181	2.97e-3	SMART
Blast:ANK	185	204	7e-6	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000174021
AA Change: N217I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000134672
Gene: ENSMUSG00000042632
AA Change: N217I

Domain	Start	End	E-Value	Type
low complexity region	96	109	N/A	INTRINSIC
ANK	151	181	2.97e-3	SMART
ANK	185	215	4.6e0	SMART
ANK	219	248	3.23e-4	SMART
ANK	286	312	1.52e0	SMART
ANK	316	345	6.46e-4	SMART
ANK	349	378	2.02e-5	SMART
Blast:ANK	382	411	2e-8	BLAST
Pfam:Patatin	482	666	2.9e-18	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174089

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174375

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.2%
20x: 94.1%

Validation Efficiency

97% (69/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an A2 phospholipase, a class of enzyme that catalyzes the release of fatty acids from phospholipids. The encoded protein may play a role in phospholipid remodelling, arachidonic acid release, leukotriene and prostaglandin synthesis, fas-mediated apoptosis, and transmembrane ion flux in glucose-stimulated B-cells. Several transcript variants encoding multiple isoforms have been described, but the full-length nature of only three of them have been determined to date. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mice display impaired male fertility and asthenozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	T	A	1: 26,682,505	D1198V	probably benign	Het
4933424G06Rik	A	T	1: 36,710,461		probably benign	Het
Adgrg6	G	T	10: 14,434,347	S743R	probably damaging	Het
Ak8	A	G	2: 28,734,448		probably null	Het
Alpk2	A	G	18: 65,349,806	M377T	probably benign	Het
Ap1g1	G	A	8: 109,844,368	V425I	possibly damaging	Het
Apob	A	T	12: 8,016,188	R4353W	probably damaging	Het
Arhgef38	T	C	3: 133,133,662	K540R	probably benign	Het
AY761184	G	A	8: 21,703,469	S45F	possibly damaging	Het
B3galt2	A	T	1: 143,646,902	T259S	possibly damaging	Het
Btbd8	G	A	5: 107,503,717	V159I	probably benign	Het
C2cd2l	T	C	9: 44,313,491		probably benign	Het
Carmil3	T	C	14: 55,499,849	V763A	possibly damaging	Het
Ccdc171	A	T	4: 83,742,997	T1115S	probably damaging	Het
Chst2	C	T	9: 95,405,750	G181D	probably damaging	Het
Col7a1	C	T	9: 108,956,633	T390M	unknown	Het
Cpt1a	A	C	19: 3,362,152	D208A	probably benign	Het
Crocc2	A	G	1: 93,214,032	E1183G	probably benign	Het
Dlg5	T	A	14: 24,158,060	H1003L	probably damaging	Het
Dok2	A	T	14: 70,775,718	I109L	probably benign	Het
Dpy19l4	A	T	4: 11,285,111	I465K	probably damaging	Het
Dync1h1	A	T	12: 110,646,205	D2838V	probably damaging	Het
Frem3	A	G	8: 80,613,015	R646G	possibly damaging	Het
Gcfc2	T	A	6: 81,946,496	F514I	probably damaging	Het
Gm8104	T	C	14: 43,101,485	M44T	probably benign	Het
Golph3l	T	A	3: 95,617,439	W334R	probably damaging	Het
Gpr179	A	T	11: 97,344,176	F443I	probably damaging	Het
Ift172	A	G	5: 31,256,583	V1467A	probably benign	Het
Ift172	A	T	5: 31,286,945	D44E	probably damaging	Het
Il1rl1	C	T	1: 40,461,856	A464V	possibly damaging	Het
Irx5	A	G	8: 92,359,853	E188G	probably damaging	Het
Jak1	A	G	4: 101,161,926	V710A	probably damaging	Het
Kcng4	A	T	8: 119,632,954	F228I	probably damaging	Het
Lifr	A	G	15: 7,167,049	N238S	probably benign	Het
Ltbp3	C	A	19: 5,747,477	H414Q	probably damaging	Het
Mcpt8	A	G	14: 56,082,337	C219R	probably benign	Het
Mepce	A	T	5: 137,785,688	N125K	possibly damaging	Het
Mfap3	T	C	11: 57,529,772	F193S	probably damaging	Het
Miox	T	A	15: 89,335,499	Y63*	probably null	Het
Msl2	A	T	9: 101,101,750	H441L	probably benign	Het
Nemp2	T	A	1: 52,640,910	S98T	possibly damaging	Het
Neto2	G	T	8: 85,640,558	A547E	probably benign	Het
Nol12	T	C	15: 78,940,833		probably benign	Het
Npr3	T	C	15: 11,845,275	I504V	probably damaging	Het
Olfr1204	A	G	2: 88,852,871	D307G	probably null	Het
Pcdhb3	T	C	18: 37,300,945		probably benign	Het
Pear1	C	A	3: 87,752,520	G720W	probably damaging	Het
Pibf1	T	G	14: 99,107,398	D151E	probably damaging	Het
Plcd1	G	A	9: 119,074,991	R292C	probably damaging	Het
Plcl1	C	T	1: 55,696,315	L272F	probably damaging	Het
Ppp4r4	A	T	12: 103,604,969	K656*	probably null	Het
Prr22	G	A	17: 56,771,490	M214I	probably benign	Het
Ror1	G	T	4: 100,411,931	R322L	possibly damaging	Het
Sh3tc2	G	A	18: 61,975,571	W244*	probably null	Het
Slamf6	A	G	1: 171,948,048	N320S	probably null	Het
Slc1a6	A	C	10: 78,800,085	D328A	possibly damaging	Het
Sorl1	G	T	9: 41,969,742	T2161K	probably benign	Het
Sstr2	T	C	11: 113,624,549	F98S	probably damaging	Het
Stk33	A	T	7: 109,321,465	D348E	probably benign	Het
Sulf1	T	A	1: 12,838,440	L559Q	probably damaging	Het
Syne2	A	G	12: 75,989,153	D3738G	probably benign	Het
Taok3	A	T	5: 117,228,030	Q382L	probably benign	Het
Tet2	T	A	3: 133,486,417	H752L	possibly damaging	Het
Tia1	A	C	6: 86,426,656	K285T	probably damaging	Het
Tle3	G	T	9: 61,401,924		probably null	Het
Top1mt	T	C	15: 75,665,656	T414A	possibly damaging	Het
Ubc	A	T	5: 125,387,342	I307N	probably damaging	Het
Vmn2r96	A	T	17: 18,583,862	D266V	possibly damaging	Het
Wbp2nl	G	T	15: 82,299,045	W13C	possibly damaging	Het
Zfp456	T	A	13: 67,362,364	K102*	probably null	Het
Zkscan1	T	C	5: 138,093,305	V100A	probably damaging	Het

Other mutations in Pla2g6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Pla2g6	APN	15	79289241	missense	probably damaging	0.96
IGL00906:Pla2g6	APN	15	79287747	missense	probably damaging	1.00
IGL01432:Pla2g6	APN	15	79317968	start codon destroyed	probably null	1.00
IGL01640:Pla2g6	APN	15	79304313	missense	probably benign
IGL01715:Pla2g6	APN	15	79317857	missense	probably benign	0.00
IGL01943:Pla2g6	APN	15	79313116	missense	probably null	0.00
IGL02551:Pla2g6	APN	15	79299094	missense	possibly damaging	0.95
IGL03120:Pla2g6	APN	15	79286860	missense	probably damaging	1.00
IGL03193:Pla2g6	APN	15	79317785	missense	probably damaging	0.98
IGL03194:Pla2g6	APN	15	79317785	missense	probably damaging	0.98
IGL03205:Pla2g6	APN	15	79317785	missense	probably damaging	0.98
IGL03289:Pla2g6	APN	15	79317785	missense	probably damaging	0.98
R0288:Pla2g6	UTSW	15	79286906	splice site	probably benign
R0631:Pla2g6	UTSW	15	79306396	missense	probably damaging	1.00
R1216:Pla2g6	UTSW	15	79306435	missense	probably benign	0.18
R1617:Pla2g6	UTSW	15	79289141	missense	probably benign	0.03
R1785:Pla2g6	UTSW	15	79306345	missense	probably benign	0.02
R2025:Pla2g6	UTSW	15	79286764	missense	probably damaging	1.00
R2079:Pla2g6	UTSW	15	79312994	missense	probably damaging	1.00
R3952:Pla2g6	UTSW	15	79313096	missense	probably damaging	1.00
R4774:Pla2g6	UTSW	15	79287618	missense	probably damaging	1.00
R4826:Pla2g6	UTSW	15	79308679	missense	possibly damaging	0.96
R5093:Pla2g6	UTSW	15	79287128	missense	probably benign	0.12
R5327:Pla2g6	UTSW	15	79302637	missense	probably benign	0.03
R5390:Pla2g6	UTSW	15	79289693	missense	possibly damaging	0.72
R5419:Pla2g6	UTSW	15	79299142	missense	possibly damaging	0.82
R5432:Pla2g6	UTSW	15	79302617	critical splice donor site	probably null
R5633:Pla2g6	UTSW	15	79299142	missense	possibly damaging	0.82
R5829:Pla2g6	UTSW	15	79287693	missense	possibly damaging	0.73
R5930:Pla2g6	UTSW	15	79303528	intron	probably benign
R6228:Pla2g6	UTSW	15	79305724	missense	probably benign	0.00
R6241:Pla2g6	UTSW	15	79304392	missense	probably benign	0.02
R6485:Pla2g6	UTSW	15	79307372	missense	probably benign	0.00
R6754:Pla2g6	UTSW	15	79306310	missense	probably benign	0.01
R7419:Pla2g6	UTSW	15	79305698	splice site	probably null
R7425:Pla2g6	UTSW	15	79308733	missense	probably damaging	1.00
R7710:Pla2g6	UTSW	15	79287158	missense	probably damaging	0.98
R7738:Pla2g6	UTSW	15	79297433	nonsense	probably null
R7768:Pla2g6	UTSW	15	79297314	missense	probably damaging	1.00
R7796:Pla2g6	UTSW	15	79317825	missense	probably benign	0.32
R8184:Pla2g6	UTSW	15	79287122	missense	probably benign	0.02
R8359:Pla2g6	UTSW	15	79287170	missense	probably damaging	0.98
R9105:Pla2g6	UTSW	15	79299197	critical splice acceptor site	probably null
R9280:Pla2g6	UTSW	15	79313114	missense	probably benign	0.09
R9471:Pla2g6	UTSW	15	79317839	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AACACTTGGTGTGAAGCCACC -3'
(R):5'- CTGGTCAGCCATTCTTACAATC -3'

Sequencing Primer
(F):5'- TTGGTGTGAAGCCACCACATAAC -3'
(R):5'- GTCAGCCATTCTTACAATCTCCAGAG -3'

Posted On

2018-04-27