Incidental Mutation 'R6339:Prr22'
ID 513857
Institutional Source Beutler Lab
Gene Symbol Prr22
Ensembl Gene ENSMUSG00000090273
Gene Name proline rich 22
Synonyms LOC224908, Gm546
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock # R6339 (G1)
Quality Score 177.009
Status Validated
Chromosome 17
Chromosomal Location 56770250-56772208 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 56771490 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 214 (M214I)
Ref Sequence ENSEMBL: ENSMUSP00000127457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002444] [ENSMUST00000007747] [ENSMUST00000086801] [ENSMUST00000168666]
AlphaFold F6TNE3
Predicted Effect probably benign
Transcript: ENSMUST00000002444
SMART Domains Protein: ENSMUSP00000002444
Gene: ENSMUSG00000024206

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 4 149 1.9e-50 PFAM
Pfam:RFX_DNA_binding 192 269 4.3e-36 PFAM
Blast:HisKA 479 542 1e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000007747
SMART Domains Protein: ENSMUSP00000007747
Gene: ENSMUSG00000007603

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Blast:ZnF_C3H1 109 136 2e-6 BLAST
Blast:ZnF_C3H1 146 172 6e-9 BLAST
Pfam:Dus 295 566 2e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086801
SMART Domains Protein: ENSMUSP00000084010
Gene: ENSMUSG00000024206

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 151 6.8e-56 PFAM
Pfam:RFX_DNA_binding 161 246 6e-41 PFAM
Blast:HisKA 454 517 1e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000168666
AA Change: M214I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000127457
Gene: ENSMUSG00000090273
AA Change: M214I

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
Pfam:PRR22 58 422 2.3e-169 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187612
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 97% (69/71)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,505 D1198V probably benign Het
4933424G06Rik A T 1: 36,710,461 probably benign Het
Adgrg6 G T 10: 14,434,347 S743R probably damaging Het
Ak8 A G 2: 28,734,448 probably null Het
Alpk2 A G 18: 65,349,806 M377T probably benign Het
Ap1g1 G A 8: 109,844,368 V425I possibly damaging Het
Apob A T 12: 8,016,188 R4353W probably damaging Het
Arhgef38 T C 3: 133,133,662 K540R probably benign Het
AY761184 G A 8: 21,703,469 S45F possibly damaging Het
B3galt2 A T 1: 143,646,902 T259S possibly damaging Het
Btbd8 G A 5: 107,503,717 V159I probably benign Het
C2cd2l T C 9: 44,313,491 probably benign Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Ccdc171 A T 4: 83,742,997 T1115S probably damaging Het
Chst2 C T 9: 95,405,750 G181D probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Cpt1a A C 19: 3,362,152 D208A probably benign Het
Crocc2 A G 1: 93,214,032 E1183G probably benign Het
Dlg5 T A 14: 24,158,060 H1003L probably damaging Het
Dok2 A T 14: 70,775,718 I109L probably benign Het
Dpy19l4 A T 4: 11,285,111 I465K probably damaging Het
Dync1h1 A T 12: 110,646,205 D2838V probably damaging Het
Frem3 A G 8: 80,613,015 R646G possibly damaging Het
Gcfc2 T A 6: 81,946,496 F514I probably damaging Het
Gm8104 T C 14: 43,101,485 M44T probably benign Het
Golph3l T A 3: 95,617,439 W334R probably damaging Het
Gpr179 A T 11: 97,344,176 F443I probably damaging Het
Ift172 A G 5: 31,256,583 V1467A probably benign Het
Ift172 A T 5: 31,286,945 D44E probably damaging Het
Il1rl1 C T 1: 40,461,856 A464V possibly damaging Het
Irx5 A G 8: 92,359,853 E188G probably damaging Het
Jak1 A G 4: 101,161,926 V710A probably damaging Het
Kcng4 A T 8: 119,632,954 F228I probably damaging Het
Lifr A G 15: 7,167,049 N238S probably benign Het
Ltbp3 C A 19: 5,747,477 H414Q probably damaging Het
Mcpt8 A G 14: 56,082,337 C219R probably benign Het
Mepce A T 5: 137,785,688 N125K possibly damaging Het
Mfap3 T C 11: 57,529,772 F193S probably damaging Het
Miox T A 15: 89,335,499 Y63* probably null Het
Msl2 A T 9: 101,101,750 H441L probably benign Het
Nemp2 T A 1: 52,640,910 S98T possibly damaging Het
Neto2 G T 8: 85,640,558 A547E probably benign Het
Nol12 T C 15: 78,940,833 probably benign Het
Npr3 T C 15: 11,845,275 I504V probably damaging Het
Olfr1204 A G 2: 88,852,871 D307G probably null Het
Pcdhb3 T C 18: 37,300,945 probably benign Het
Pear1 C A 3: 87,752,520 G720W probably damaging Het
Pibf1 T G 14: 99,107,398 D151E probably damaging Het
Pla2g6 T A 15: 79,308,816 N217I probably damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Plcl1 C T 1: 55,696,315 L272F probably damaging Het
Ppp4r4 A T 12: 103,604,969 K656* probably null Het
Ror1 G T 4: 100,411,931 R322L possibly damaging Het
Sh3tc2 G A 18: 61,975,571 W244* probably null Het
Slamf6 A G 1: 171,948,048 N320S probably null Het
Slc1a6 A C 10: 78,800,085 D328A possibly damaging Het
Sorl1 G T 9: 41,969,742 T2161K probably benign Het
Sstr2 T C 11: 113,624,549 F98S probably damaging Het
Stk33 A T 7: 109,321,465 D348E probably benign Het
Sulf1 T A 1: 12,838,440 L559Q probably damaging Het
Syne2 A G 12: 75,989,153 D3738G probably benign Het
Taok3 A T 5: 117,228,030 Q382L probably benign Het
Tet2 T A 3: 133,486,417 H752L possibly damaging Het
Tia1 A C 6: 86,426,656 K285T probably damaging Het
Tle3 G T 9: 61,401,924 probably null Het
Top1mt T C 15: 75,665,656 T414A possibly damaging Het
Ubc A T 5: 125,387,342 I307N probably damaging Het
Vmn2r96 A T 17: 18,583,862 D266V possibly damaging Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zfp456 T A 13: 67,362,364 K102* probably null Het
Zkscan1 T C 5: 138,093,305 V100A probably damaging Het
Other mutations in Prr22
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0462:Prr22 UTSW 17 56770551 unclassified probably benign
R0787:Prr22 UTSW 17 56771072 missense possibly damaging 0.71
R2290:Prr22 UTSW 17 56771884 missense probably benign
R4749:Prr22 UTSW 17 56771274 missense possibly damaging 0.51
R5099:Prr22 UTSW 17 56771467 missense probably benign 0.32
R6268:Prr22 UTSW 17 56771587 missense probably damaging 0.98
R6542:Prr22 UTSW 17 56770527 splice site probably null
R6951:Prr22 UTSW 17 56772028 nonsense probably null
R6991:Prr22 UTSW 17 56771345 missense possibly damaging 0.92
R7721:Prr22 UTSW 17 56771819 missense possibly damaging 0.92
R8352:Prr22 UTSW 17 56771311 missense probably damaging 1.00
R8452:Prr22 UTSW 17 56771311 missense probably damaging 1.00
R9479:Prr22 UTSW 17 56771335 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATTACCTTCCAGCGGAGG -3'
(R):5'- CATCTTCGAGAAGGACCTTGTC -3'

Sequencing Primer
(F):5'- ACGGAGGGCCTCTCAACTTC -3'
(R):5'- TCCGGTAGGAAGAACGCAC -3'
Posted On 2018-04-27