Incidental Mutation 'R6340:B020011L13Rik'
ID513866
Institutional Source Beutler Lab
Gene Symbol B020011L13Rik
Ensembl Gene ENSMUSG00000101303
Gene NameRIKEN cDNA B020011L13 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R6340 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location117781133-117803359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117801884 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 374 (V374I)
Ref Sequence ENSEMBL: ENSMUSP00000140211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000188801]
Predicted Effect probably benign
Transcript: ENSMUST00000188801
AA Change: V374I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000140211
Gene: ENSMUSG00000101303
AA Change: V374I

DomainStartEndE-ValueType
KRAB 8 66 6.9e-26 SMART
ZnF_C2H2 77 99 8.3e-6 SMART
ZnF_C2H2 105 127 1.8e-5 SMART
ZnF_C2H2 133 155 8.7e-4 SMART
ZnF_C2H2 161 183 2.1e-4 SMART
ZnF_C2H2 189 211 1.1e-7 SMART
ZnF_C2H2 217 239 4e-5 SMART
ZnF_C2H2 245 267 1.6e-7 SMART
ZnF_C2H2 273 295 5.4e-7 SMART
ZnF_C2H2 301 323 5.1e-4 SMART
ZnF_C2H2 329 351 1.1e-1 SMART
ZnF_C2H2 357 379 3.4e-6 SMART
ZnF_C2H2 385 407 3.2e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 C T 1: 34,732,223 L1204F probably damaging Het
Atp9b T C 18: 80,778,900 D495G probably benign Het
Babam1 T A 8: 71,402,805 V214D probably damaging Het
Chpf2 T C 5: 24,591,775 V573A probably damaging Het
Elmo3 T A 8: 105,306,747 I115N probably damaging Het
Emc1 T A 4: 139,365,563 Y564N probably damaging Het
Fam180a A C 6: 35,315,387 L28R probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Fnip2 A G 3: 79,507,845 F243L probably damaging Het
Gabra5 A T 7: 57,413,748 N309K probably damaging Het
Gm17654 A G 14: 43,578,077 L91P unknown Het
Gm19684 G A 17: 36,127,510 probably null Het
Gm9376 A T 14: 118,267,257 M34L unknown Het
Hmgcr A G 13: 96,665,858 F106S probably damaging Het
Hydin T G 8: 110,354,942 probably null Het
Igf2bp3 A G 6: 49,214,459 Y5H probably damaging Het
Igsf11 A G 16: 39,008,974 T77A probably benign Het
Il20 A G 1: 130,908,381 Y142H probably benign Het
Macf1 A T 4: 123,448,249 D2160E probably benign Het
Melk A G 4: 44,340,633 Y310C probably damaging Het
Mep1a C T 17: 43,479,058 V454M probably benign Het
Mep1a A T 17: 43,479,233 N395K probably benign Het
Mnt A G 11: 74,836,416 K43E probably damaging Het
Nrap A G 19: 56,347,184 I853T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr341 T C 2: 36,480,020 T37A probably benign Het
Olfr933 T G 9: 38,975,766 L30R probably damaging Het
Pdia4 A G 6: 47,801,018 S347P probably benign Het
Pkd1l1 T G 11: 8,844,649 Q1837H probably benign Het
Pramef6 T C 4: 143,897,307 N99S possibly damaging Het
Pygo1 T A 9: 72,945,429 N299K probably damaging Het
Sirpb1b A T 3: 15,548,665 V52E probably damaging Het
Tdrd7 T A 4: 45,994,517 I305N probably damaging Het
Trav14-1 T C 14: 53,554,498 S102P probably damaging Het
Tsga10 C A 1: 37,835,185 probably benign Het
Uso1 T A 5: 92,199,852 H837Q probably benign Het
Vmn2r82 A T 10: 79,395,893 R575S probably benign Het
Yae1d1 C A 13: 17,993,276 A11S probably benign Het
Zfp277 A G 12: 40,318,549 I459T possibly damaging Het
Other mutations in B020011L13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:B020011L13Rik APN 1 117782969 missense possibly damaging 0.77
R6785:B020011L13Rik UTSW 1 117801069 missense possibly damaging 0.78
R6857:B020011L13Rik UTSW 1 117801288 missense probably benign 0.00
R7027:B020011L13Rik UTSW 1 117801450 missense probably benign 0.38
R7210:B020011L13Rik UTSW 1 117801511 missense possibly damaging 0.57
R7246:B020011L13Rik UTSW 1 117801239 nonsense probably null
R7513:B020011L13Rik UTSW 1 117801419 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGACAAACCTTGCAAATGT -3'
(R):5'- AACTTGAAGAGATGAGGAATCTGT -3'

Sequencing Primer
(F):5'- ACCTTGCAAATGTAATGATTGTGGG -3'
(R):5'- CTGGTGAACTTCAAGATTTGAGGAC -3'
Posted On2018-04-27