Incidental Mutation 'R6340:Olfr341'
ID513868
Institutional Source Beutler Lab
Gene Symbol Olfr341
Ensembl Gene ENSMUSG00000075387
Gene Nameolfactory receptor 341
SynonymsGA_x6K02T2NLDC-33174915-33173974, MOR136-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6340 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location36473721-36482468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36480020 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 37 (T37A)
Ref Sequence ENSEMBL: ENSMUSP00000150801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100154] [ENSMUST00000213300]
Predicted Effect probably benign
Transcript: ENSMUST00000100154
AA Change: T37A

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097731
Gene: ENSMUSG00000075387
AA Change: T37A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.6e-59 PFAM
Pfam:7TM_GPCR_Srsx 35 305 4e-6 PFAM
Pfam:7tm_1 41 290 9.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213300
AA Change: T37A

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 C T 1: 34,732,223 L1204F probably damaging Het
Atp9b T C 18: 80,778,900 D495G probably benign Het
B020011L13Rik G A 1: 117,801,884 V374I probably benign Het
Babam1 T A 8: 71,402,805 V214D probably damaging Het
Chpf2 T C 5: 24,591,775 V573A probably damaging Het
Elmo3 T A 8: 105,306,747 I115N probably damaging Het
Emc1 T A 4: 139,365,563 Y564N probably damaging Het
Fam180a A C 6: 35,315,387 L28R probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Fnip2 A G 3: 79,507,845 F243L probably damaging Het
Gabra5 A T 7: 57,413,748 N309K probably damaging Het
Gm17654 A G 14: 43,578,077 L91P unknown Het
Gm19684 G A 17: 36,127,510 probably null Het
Gm9376 A T 14: 118,267,257 M34L unknown Het
Hmgcr A G 13: 96,665,858 F106S probably damaging Het
Hydin T G 8: 110,354,942 probably null Het
Igf2bp3 A G 6: 49,214,459 Y5H probably damaging Het
Igsf11 A G 16: 39,008,974 T77A probably benign Het
Il20 A G 1: 130,908,381 Y142H probably benign Het
Macf1 A T 4: 123,448,249 D2160E probably benign Het
Melk A G 4: 44,340,633 Y310C probably damaging Het
Mep1a C T 17: 43,479,058 V454M probably benign Het
Mep1a A T 17: 43,479,233 N395K probably benign Het
Mnt A G 11: 74,836,416 K43E probably damaging Het
Nrap A G 19: 56,347,184 I853T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr933 T G 9: 38,975,766 L30R probably damaging Het
Pdia4 A G 6: 47,801,018 S347P probably benign Het
Pkd1l1 T G 11: 8,844,649 Q1837H probably benign Het
Pramef6 T C 4: 143,897,307 N99S possibly damaging Het
Pygo1 T A 9: 72,945,429 N299K probably damaging Het
Sirpb1b A T 3: 15,548,665 V52E probably damaging Het
Tdrd7 T A 4: 45,994,517 I305N probably damaging Het
Trav14-1 T C 14: 53,554,498 S102P probably damaging Het
Tsga10 C A 1: 37,835,185 probably benign Het
Uso1 T A 5: 92,199,852 H837Q probably benign Het
Vmn2r82 A T 10: 79,395,893 R575S probably benign Het
Yae1d1 C A 13: 17,993,276 A11S probably benign Het
Zfp277 A G 12: 40,318,549 I459T possibly damaging Het
Other mutations in Olfr341
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Olfr341 APN 2 36479356 missense probably damaging 1.00
IGL01469:Olfr341 APN 2 36479824 missense probably benign 0.44
IGL02269:Olfr341 APN 2 36479567 missense possibly damaging 0.86
IGL02870:Olfr341 APN 2 36480031 missense probably benign
IGL03190:Olfr341 APN 2 36479722 missense probably damaging 1.00
R0988:Olfr341 UTSW 2 36479767 missense probably damaging 1.00
R1214:Olfr341 UTSW 2 36479969 missense possibly damaging 0.67
R1785:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R1786:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2130:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2131:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2132:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2133:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2568:Olfr341 UTSW 2 36479974 missense probably damaging 1.00
R4115:Olfr341 UTSW 2 36479785 missense probably damaging 1.00
R4384:Olfr341 UTSW 2 36479998 missense probably damaging 1.00
R4721:Olfr341 UTSW 2 36479824 missense probably benign 0.44
R5375:Olfr341 UTSW 2 36479297 missense probably damaging 0.98
R6035:Olfr341 UTSW 2 36479984 missense probably damaging 1.00
R6035:Olfr341 UTSW 2 36479984 missense probably damaging 1.00
R6084:Olfr341 UTSW 2 36479512 missense probably benign 0.01
R7238:Olfr341 UTSW 2 36479714 missense possibly damaging 0.54
R7532:Olfr341 UTSW 2 36480126 start codon destroyed probably null 0.27
R7830:Olfr341 UTSW 2 36479380 missense probably damaging 1.00
R7910:Olfr341 UTSW 2 36479333 missense probably damaging 0.98
R7991:Olfr341 UTSW 2 36479333 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCAGCATATGAGATGGACTGAC -3'
(R):5'- GGCACCTTGATCTGGAAATGG -3'

Sequencing Primer
(F):5'- CTGTGTGTCAGCATATTCATGAGC -3'
(R):5'- ATCACAGCTCATTTTTGTCACAG -3'
Posted On2018-04-27