Incidental Mutation 'R6340:Emc1'
ID513874
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene NameER membrane protein complex subunit 1
SynonymsC230096C10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6340 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location139352587-139378730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139365563 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 564 (Y564N)
Ref Sequence ENSEMBL: ENSMUSP00000080888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042096
AA Change: Y561N

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: Y561N

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000082262
AA Change: Y564N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: Y564N

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect possibly damaging
Transcript: ENSMUST00000179784
AA Change: Y564N

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: Y564N

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Meta Mutation Damage Score 0.4860 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 C T 1: 34,732,223 L1204F probably damaging Het
Atp9b T C 18: 80,778,900 D495G probably benign Het
B020011L13Rik G A 1: 117,801,884 V374I probably benign Het
Babam1 T A 8: 71,402,805 V214D probably damaging Het
Chpf2 T C 5: 24,591,775 V573A probably damaging Het
Elmo3 T A 8: 105,306,747 I115N probably damaging Het
Fam180a A C 6: 35,315,387 L28R probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Fnip2 A G 3: 79,507,845 F243L probably damaging Het
Gabra5 A T 7: 57,413,748 N309K probably damaging Het
Gm17654 A G 14: 43,578,077 L91P unknown Het
Gm19684 G A 17: 36,127,510 probably null Het
Gm9376 A T 14: 118,267,257 M34L unknown Het
Hmgcr A G 13: 96,665,858 F106S probably damaging Het
Hydin T G 8: 110,354,942 probably null Het
Igf2bp3 A G 6: 49,214,459 Y5H probably damaging Het
Igsf11 A G 16: 39,008,974 T77A probably benign Het
Il20 A G 1: 130,908,381 Y142H probably benign Het
Macf1 A T 4: 123,448,249 D2160E probably benign Het
Melk A G 4: 44,340,633 Y310C probably damaging Het
Mep1a C T 17: 43,479,058 V454M probably benign Het
Mep1a A T 17: 43,479,233 N395K probably benign Het
Mnt A G 11: 74,836,416 K43E probably damaging Het
Nrap A G 19: 56,347,184 I853T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr341 T C 2: 36,480,020 T37A probably benign Het
Olfr933 T G 9: 38,975,766 L30R probably damaging Het
Pdia4 A G 6: 47,801,018 S347P probably benign Het
Pkd1l1 T G 11: 8,844,649 Q1837H probably benign Het
Pramef6 T C 4: 143,897,307 N99S possibly damaging Het
Pygo1 T A 9: 72,945,429 N299K probably damaging Het
Sirpb1b A T 3: 15,548,665 V52E probably damaging Het
Tdrd7 T A 4: 45,994,517 I305N probably damaging Het
Trav14-1 T C 14: 53,554,498 S102P probably damaging Het
Tsga10 C A 1: 37,835,185 probably benign Het
Uso1 T A 5: 92,199,852 H837Q probably benign Het
Vmn2r82 A T 10: 79,395,893 R575S probably benign Het
Yae1d1 C A 13: 17,993,276 A11S probably benign Het
Zfp277 A G 12: 40,318,549 I459T possibly damaging Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139355082 splice site probably benign
IGL00898:Emc1 APN 4 139371630 missense probably damaging 1.00
IGL01481:Emc1 APN 4 139362099 missense probably benign 0.00
IGL02174:Emc1 APN 4 139371668 missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139375464 missense probably damaging 1.00
IGL02501:Emc1 APN 4 139370984 missense probably benign 0.00
IGL02697:Emc1 APN 4 139352644 missense probably benign
IGL03355:Emc1 APN 4 139371593 splice site probably benign
IGL03386:Emc1 APN 4 139363781 critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139359277 missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0051:Emc1 UTSW 4 139375163 missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139360485 missense probably damaging 0.99
R0613:Emc1 UTSW 4 139375072 splice site probably benign
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1512:Emc1 UTSW 4 139360184 splice site probably null
R1702:Emc1 UTSW 4 139375201 missense probably damaging 1.00
R1839:Emc1 UTSW 4 139360485 missense probably damaging 0.98
R1843:Emc1 UTSW 4 139375512 missense probably benign 0.02
R1850:Emc1 UTSW 4 139359373 splice site probably benign
R2024:Emc1 UTSW 4 139360946 missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139366530 missense probably benign 0.08
R2912:Emc1 UTSW 4 139365260 missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139363185 nonsense probably null
R4738:Emc1 UTSW 4 139362202 missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139375165 nonsense probably null
R5033:Emc1 UTSW 4 139371696 missense probably damaging 1.00
R5322:Emc1 UTSW 4 139354246 missense probably damaging 1.00
R5375:Emc1 UTSW 4 139366491 missense probably damaging 0.96
R5483:Emc1 UTSW 4 139375376 missense probably damaging 1.00
R5587:Emc1 UTSW 4 139362148 missense probably damaging 0.98
R5687:Emc1 UTSW 4 139375380 missense probably damaging 1.00
R5938:Emc1 UTSW 4 139357620 missense probably benign
R6056:Emc1 UTSW 4 139354222 missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139366378 missense probably benign 0.01
R6174:Emc1 UTSW 4 139366531 missense probably benign 0.01
R6208:Emc1 UTSW 4 139354271 missense probably damaging 0.99
R6371:Emc1 UTSW 4 139371665 nonsense probably null
R6889:Emc1 UTSW 4 139365350 missense probably damaging 0.97
R7592:Emc1 UTSW 4 139360566 missense probably benign 0.00
R7699:Emc1 UTSW 4 139354870 missense probably benign
R7715:Emc1 UTSW 4 139371623 missense probably damaging 1.00
R7984:Emc1 UTSW 4 139375449 missense probably damaging 1.00
R8112:Emc1 UTSW 4 139367187 missense probably benign 0.00
R8325:Emc1 UTSW 4 139365210 missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139361289 missense probably benign
R8751:Emc1 UTSW 4 139369968 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AATGATGGTGACGGTAACAGCC -3'
(R):5'- AGAGCTTCTCATGGAATGCC -3'

Sequencing Primer
(F):5'- TGACGGTAACAGCCTCAGG -3'
(R):5'- CCAAAACATGGGAGAAATCTCAGCTG -3'
Posted On2018-04-27