Incidental Mutation 'R6340:Chpf2'
ID513877
Institutional Source Beutler Lab
Gene Symbol Chpf2
Ensembl Gene ENSMUSG00000038181
Gene Namechondroitin polymerizing factor 2
Synonyms2010209O12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6340 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location24586741-24594556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24591775 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 573 (V573A)
Ref Sequence ENSEMBL: ENSMUSP00000112804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030791] [ENSMUST00000088295] [ENSMUST00000121863] [ENSMUST00000195943] [ENSMUST00000197318]
Predicted Effect probably benign
Transcript: ENSMUST00000030791
SMART Domains Protein: ENSMUSP00000030791
Gene: ENSMUSG00000028949

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
Blast:KISc 103 239 5e-41 BLAST
SWIB 259 338 3.6e-29 SMART
Blast:MYSc 420 466 1e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000088295
AA Change: V573A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085633
Gene: ENSMUSG00000038181
AA Change: V573A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 1.7e-144 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102432
Predicted Effect probably damaging
Transcript: ENSMUST00000121863
AA Change: V573A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112804
Gene: ENSMUSG00000038181
AA Change: V573A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 3e-176 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147857
Predicted Effect probably benign
Transcript: ENSMUST00000195943
SMART Domains Protein: ENSMUSP00000143437
Gene: ENSMUSG00000028949

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 43 60 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:KISc 74 210 2e-41 BLAST
SWIB 230 309 2.3e-31 SMART
Blast:MYSc 391 437 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197318
SMART Domains Protein: ENSMUSP00000143185
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
Pfam:CHGN 1 74 7.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197933
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 C T 1: 34,732,223 L1204F probably damaging Het
Atp9b T C 18: 80,778,900 D495G probably benign Het
B020011L13Rik G A 1: 117,801,884 V374I probably benign Het
Babam1 T A 8: 71,402,805 V214D probably damaging Het
Elmo3 T A 8: 105,306,747 I115N probably damaging Het
Emc1 T A 4: 139,365,563 Y564N probably damaging Het
Fam180a A C 6: 35,315,387 L28R probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Fnip2 A G 3: 79,507,845 F243L probably damaging Het
Gabra5 A T 7: 57,413,748 N309K probably damaging Het
Gm17654 A G 14: 43,578,077 L91P unknown Het
Gm19684 G A 17: 36,127,510 probably null Het
Gm9376 A T 14: 118,267,257 M34L unknown Het
Hmgcr A G 13: 96,665,858 F106S probably damaging Het
Hydin T G 8: 110,354,942 probably null Het
Igf2bp3 A G 6: 49,214,459 Y5H probably damaging Het
Igsf11 A G 16: 39,008,974 T77A probably benign Het
Il20 A G 1: 130,908,381 Y142H probably benign Het
Macf1 A T 4: 123,448,249 D2160E probably benign Het
Melk A G 4: 44,340,633 Y310C probably damaging Het
Mep1a C T 17: 43,479,058 V454M probably benign Het
Mep1a A T 17: 43,479,233 N395K probably benign Het
Mnt A G 11: 74,836,416 K43E probably damaging Het
Nrap A G 19: 56,347,184 I853T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr341 T C 2: 36,480,020 T37A probably benign Het
Olfr933 T G 9: 38,975,766 L30R probably damaging Het
Pdia4 A G 6: 47,801,018 S347P probably benign Het
Pkd1l1 T G 11: 8,844,649 Q1837H probably benign Het
Pramef6 T C 4: 143,897,307 N99S possibly damaging Het
Pygo1 T A 9: 72,945,429 N299K probably damaging Het
Sirpb1b A T 3: 15,548,665 V52E probably damaging Het
Tdrd7 T A 4: 45,994,517 I305N probably damaging Het
Trav14-1 T C 14: 53,554,498 S102P probably damaging Het
Tsga10 C A 1: 37,835,185 probably benign Het
Uso1 T A 5: 92,199,852 H837Q probably benign Het
Vmn2r82 A T 10: 79,395,893 R575S probably benign Het
Yae1d1 C A 13: 17,993,276 A11S probably benign Het
Zfp277 A G 12: 40,318,549 I459T possibly damaging Het
Other mutations in Chpf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Chpf2 APN 5 24592261 missense probably damaging 1.00
IGL02110:Chpf2 APN 5 24591712 missense probably damaging 1.00
IGL02625:Chpf2 APN 5 24591711 nonsense probably null
IGL02673:Chpf2 APN 5 24591304 missense probably benign 0.21
R0545:Chpf2 UTSW 5 24590324 missense possibly damaging 0.89
R0571:Chpf2 UTSW 5 24590427 missense probably damaging 1.00
R0732:Chpf2 UTSW 5 24590421 start codon destroyed probably null 0.94
R1196:Chpf2 UTSW 5 24589648 missense possibly damaging 0.61
R2051:Chpf2 UTSW 5 24591276 missense probably benign 0.00
R2057:Chpf2 UTSW 5 24591222 missense probably damaging 1.00
R2147:Chpf2 UTSW 5 24592035 missense probably damaging 1.00
R3719:Chpf2 UTSW 5 24590312 nonsense probably null
R4168:Chpf2 UTSW 5 24591790 missense possibly damaging 0.86
R4632:Chpf2 UTSW 5 24591831 missense probably benign
R5278:Chpf2 UTSW 5 24588090 intron probably benign
R5481:Chpf2 UTSW 5 24589342 missense probably damaging 1.00
R5853:Chpf2 UTSW 5 24592192 missense probably damaging 1.00
R5914:Chpf2 UTSW 5 24592423 unclassified probably benign
R6010:Chpf2 UTSW 5 24591919 missense probably damaging 1.00
R6463:Chpf2 UTSW 5 24589526 missense probably damaging 1.00
R8012:Chpf2 UTSW 5 24590345 missense probably damaging 0.98
R8506:Chpf2 UTSW 5 24588297 missense probably damaging 1.00
Z1177:Chpf2 UTSW 5 24591519 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGAGAACATGCATTGCTCAC -3'
(R):5'- TGAAGCCTGCCGGTCAAATC -3'

Sequencing Primer
(F):5'- AACATGCATTGCTCACCCTGTTG -3'
(R):5'- ACACCTGGGGGAGATCTCTG -3'
Posted On2018-04-27