Incidental Mutation 'R6340:Elmo3'
ID 513885
Institutional Source Beutler Lab
Gene Symbol Elmo3
Ensembl Gene ENSMUSG00000014791
Gene Name engulfment and cell motility 3
Synonyms CED-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6340 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 105305601-105310760 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 105306747 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 115 (I115N)
Ref Sequence ENSEMBL: ENSMUSP00000148820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015003] [ENSMUST00000109375] [ENSMUST00000212033] [ENSMUST00000212046]
AlphaFold Q8BYZ7
Predicted Effect probably benign
Transcript: ENSMUST00000015003
SMART Domains Protein: ENSMUSP00000015003
Gene: ENSMUSG00000014859

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
E2F_TDP 17 83 3.56e-31 SMART
Pfam:E2F_CC-MB 100 196 2.8e-36 PFAM
low complexity region 201 252 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093622
Predicted Effect probably damaging
Transcript: ENSMUST00000109375
AA Change: I132N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105000
Gene: ENSMUSG00000014791
AA Change: I132N

DomainStartEndE-ValueType
Pfam:DUF3361 115 268 3.8e-55 PFAM
Pfam:ELMO_CED12 291 468 1.1e-42 PFAM
PH 542 665 2.17e0 SMART
low complexity region 694 706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184892
Predicted Effect probably damaging
Transcript: ENSMUST00000212033
AA Change: I115N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212655
Meta Mutation Damage Score 0.8863 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to a C. elegans protein that functions in phagocytosis of apoptotic cells and in cell migration. Other members of this small family of engulfment and cell motility (ELMO) proteins have been shown to interact with the dedicator of cyto-kinesis 1 protein to promote phagocytosis and effect cell shape changes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 C T 1: 34,732,223 L1204F probably damaging Het
Atp9b T C 18: 80,778,900 D495G probably benign Het
B020011L13Rik G A 1: 117,801,884 V374I probably benign Het
Babam1 T A 8: 71,402,805 V214D probably damaging Het
Chpf2 T C 5: 24,591,775 V573A probably damaging Het
Emc1 T A 4: 139,365,563 Y564N probably damaging Het
Fam180a A C 6: 35,315,387 L28R probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Fnip2 A G 3: 79,507,845 F243L probably damaging Het
Gabra5 A T 7: 57,413,748 N309K probably damaging Het
Gm17654 A G 14: 43,578,077 L91P unknown Het
Gm19684 G A 17: 36,127,510 probably null Het
Gm9376 A T 14: 118,267,257 M34L unknown Het
Hmgcr A G 13: 96,665,858 F106S probably damaging Het
Hydin T G 8: 110,354,942 probably null Het
Igf2bp3 A G 6: 49,214,459 Y5H probably damaging Het
Igsf11 A G 16: 39,008,974 T77A probably benign Het
Il20 A G 1: 130,908,381 Y142H probably benign Het
Macf1 A T 4: 123,448,249 D2160E probably benign Het
Melk A G 4: 44,340,633 Y310C probably damaging Het
Mep1a C T 17: 43,479,058 V454M probably benign Het
Mep1a A T 17: 43,479,233 N395K probably benign Het
Mnt A G 11: 74,836,416 K43E probably damaging Het
Nrap A G 19: 56,347,184 I853T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr341 T C 2: 36,480,020 T37A probably benign Het
Olfr933 T G 9: 38,975,766 L30R probably damaging Het
Pdia4 A G 6: 47,801,018 S347P probably benign Het
Pkd1l1 T G 11: 8,844,649 Q1837H probably benign Het
Pramef6 T C 4: 143,897,307 N99S possibly damaging Het
Pygo1 T A 9: 72,945,429 N299K probably damaging Het
Sirpb1b A T 3: 15,548,665 V52E probably damaging Het
Tdrd7 T A 4: 45,994,517 I305N probably damaging Het
Trav14-1 T C 14: 53,554,498 S102P probably damaging Het
Tsga10 C A 1: 37,835,185 probably benign Het
Uso1 T A 5: 92,199,852 H837Q probably benign Het
Vmn2r82 A T 10: 79,395,893 R575S probably benign Het
Yae1d1 C A 13: 17,993,276 A11S probably benign Het
Zfp277 A G 12: 40,318,549 I459T possibly damaging Het
Other mutations in Elmo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Elmo3 APN 8 105308323 missense probably benign 0.22
IGL02580:Elmo3 APN 8 105308494 missense probably damaging 1.00
IGL03126:Elmo3 APN 8 105306381 missense probably damaging 1.00
IGL03349:Elmo3 APN 8 105306388 missense possibly damaging 0.95
R0119:Elmo3 UTSW 8 105309768 missense probably damaging 1.00
R0244:Elmo3 UTSW 8 105309171 missense probably benign 0.03
R1572:Elmo3 UTSW 8 105308301 missense probably benign 0.03
R1861:Elmo3 UTSW 8 105308581 missense probably damaging 1.00
R2143:Elmo3 UTSW 8 105308673 missense probably damaging 1.00
R2344:Elmo3 UTSW 8 105309161 missense probably damaging 1.00
R2920:Elmo3 UTSW 8 105308059 missense possibly damaging 0.61
R3687:Elmo3 UTSW 8 105308836 critical splice donor site probably null
R3944:Elmo3 UTSW 8 105309220 critical splice donor site probably null
R4992:Elmo3 UTSW 8 105309501 nonsense probably null
R5255:Elmo3 UTSW 8 105307353 missense probably benign 0.08
R5976:Elmo3 UTSW 8 105307647 missense probably damaging 1.00
R6826:Elmo3 UTSW 8 105306746 missense probably damaging 1.00
R7541:Elmo3 UTSW 8 105306714 missense probably damaging 1.00
R7788:Elmo3 UTSW 8 105308244 missense probably damaging 0.98
R7860:Elmo3 UTSW 8 105309017 missense probably damaging 1.00
R8553:Elmo3 UTSW 8 105307178 missense probably benign 0.02
V8831:Elmo3 UTSW 8 105307061 missense probably benign 0.24
X0060:Elmo3 UTSW 8 105306013 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCCAGTTGTAGGGGTAACATTCTC -3'
(R):5'- AGGAGATGCTGAGTGTCTCC -3'

Sequencing Primer
(F):5'- GTAGGGGTAACATTCTCTAACCAC -3'
(R):5'- ATGCTGAGTGTCTCCCAGGAC -3'
Posted On 2018-04-27