Incidental Mutation 'R6342:Olfr586'
ID513918
Institutional Source Beutler Lab
Gene Symbol Olfr586
Ensembl Gene ENSMUSG00000066268
Gene Nameolfactory receptor 586
SynonymsMOR8-7, GA_x6K02T2PBJ9-5836380-5835439, MOR8-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R6342 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103118403-103125638 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103122356 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 143 (T143A)
Ref Sequence ENSEMBL: ENSMUSP00000081872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084811] [ENSMUST00000211075] [ENSMUST00000213281] [ENSMUST00000215304]
Predicted Effect probably damaging
Transcript: ENSMUST00000084811
AA Change: T143A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081872
Gene: ENSMUSG00000066268
AA Change: T143A

DomainStartEndE-ValueType
Pfam:7tm_4 37 315 6.1e-111 PFAM
Pfam:7TM_GPCR_Srsx 41 312 1.6e-11 PFAM
Pfam:7tm_1 47 297 1.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211075
AA Change: T139A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000213281
AA Change: T139A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000215304
AA Change: T139A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa9 T C 3: 95,296,790 *346W probably null Het
Ap4b1 T C 3: 103,813,368 V118A possibly damaging Het
Atrnl1 T C 19: 57,638,510 S183P probably damaging Het
Cadm3 T C 1: 173,341,108 T298A possibly damaging Het
Crtc1 A C 8: 70,439,557 M1R probably null Het
Dalrd3 A T 9: 108,571,123 K291* probably null Het
Dhrs9 C T 2: 69,393,187 T93M probably benign Het
Dnmt1 G T 9: 20,909,793 S1267* probably null Het
Dsg1b T C 18: 20,390,243 I109T probably damaging Het
Epha3 C A 16: 63,583,500 R745L probably damaging Het
Evi2 A G 11: 79,515,958 S264P probably benign Het
Grin2a A T 16: 9,579,334 L963Q probably damaging Het
Klhdc7a T A 4: 139,967,059 R192S probably benign Het
Kynu G T 2: 43,681,451 D460Y probably benign Het
Lrfn2 G A 17: 49,097,000 G717D probably benign Het
Lrp3 C T 7: 35,202,306 D696N probably benign Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Rad17 A T 13: 100,619,136 I579N probably damaging Het
Rif1 T A 2: 52,119,156 Y2316N probably damaging Het
Ros1 T A 10: 52,155,255 D430V probably damaging Het
Rp9 A T 9: 22,449,858 H44Q probably damaging Het
Rtl1 T C 12: 109,592,301 T1035A possibly damaging Het
Slc2a5 A C 4: 150,139,526 D225A possibly damaging Het
Tlx3 A T 11: 33,202,567 V176E possibly damaging Het
Trpv3 G A 11: 73,283,863 G352D probably damaging Het
Ubr4 C A 4: 139,429,539 H2292N possibly damaging Het
Wee2 A G 6: 40,444,255 H93R probably benign Het
Xirp2 T G 2: 67,511,650 L1412V possibly damaging Het
Zfat T C 15: 68,180,982 H321R probably damaging Het
Zfp623 C A 15: 75,947,988 C264* probably null Het
Zfp687 G C 3: 95,011,877 P195A probably benign Het
Other mutations in Olfr586
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02708:Olfr586 APN 7 103121820 utr 3 prime probably benign
R0502:Olfr586 UTSW 7 103122436 missense possibly damaging 0.94
R0503:Olfr586 UTSW 7 103122436 missense possibly damaging 0.94
R0508:Olfr586 UTSW 7 103121986 missense possibly damaging 0.93
R0882:Olfr586 UTSW 7 103122575 missense probably benign 0.09
R0962:Olfr586 UTSW 7 103122010 missense possibly damaging 0.50
R1112:Olfr586 UTSW 7 103122404 missense probably damaging 1.00
R2226:Olfr586 UTSW 7 103121908 missense probably benign 0.06
R4285:Olfr586 UTSW 7 103122660 nonsense probably null
R5817:Olfr586 UTSW 7 103121908 missense possibly damaging 0.94
R6380:Olfr586 UTSW 7 103121929 missense probably benign 0.02
R6565:Olfr586 UTSW 7 103122238 missense probably damaging 0.99
R7861:Olfr586 UTSW 7 103122692 missense probably benign 0.03
R7944:Olfr586 UTSW 7 103122692 missense probably benign 0.03
RF020:Olfr586 UTSW 7 103121891 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCAAGGATGCCTGTGAGAGC -3'
(R):5'- GACCTGGGACTGTCCATTTC -3'

Sequencing Primer
(F):5'- ATGACATTGAACTTGTTGTCTGAGC -3'
(R):5'- CTCTCTTCCTACCATGCTTAAGG -3'
Posted On2018-04-27