Incidental Mutation 'R6342:Crtc1'
ID513919
Institutional Source Beutler Lab
Gene Symbol Crtc1
Ensembl Gene ENSMUSG00000003575
Gene NameCREB regulated transcription coactivator 1
SynonymsMect1, TORC1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R6342 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70382355-70439579 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to C at 70439557 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 1 (M1R)
Ref Sequence ENSEMBL: ENSMUSP00000075916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076615]
Predicted Effect probably null
Transcript: ENSMUST00000076615
AA Change: M1R

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075916
Gene: ENSMUSG00000003575
AA Change: M1R

DomainStartEndE-ValueType
Pfam:TORC_N 6 66 1.1e-26 PFAM
Pfam:TORC_M 148 289 4.8e-64 PFAM
low complexity region 359 394 N/A INTRINSIC
Pfam:TORC_C 555 630 9.2e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142769
Meta Mutation Damage Score 0.9625 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 97% (31/32)
MGI Phenotype PHENOTYPE: Mice homozygous for an inactivating mutation in this gene are hyperphagic, obese and infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa9 T C 3: 95,296,790 *346W probably null Het
Ap4b1 T C 3: 103,813,368 V118A possibly damaging Het
Atrnl1 T C 19: 57,638,510 S183P probably damaging Het
Cadm3 T C 1: 173,341,108 T298A possibly damaging Het
Dalrd3 A T 9: 108,571,123 K291* probably null Het
Dhrs9 C T 2: 69,393,187 T93M probably benign Het
Dnmt1 G T 9: 20,909,793 S1267* probably null Het
Dsg1b T C 18: 20,390,243 I109T probably damaging Het
Epha3 C A 16: 63,583,500 R745L probably damaging Het
Evi2 A G 11: 79,515,958 S264P probably benign Het
Grin2a A T 16: 9,579,334 L963Q probably damaging Het
Klhdc7a T A 4: 139,967,059 R192S probably benign Het
Kynu G T 2: 43,681,451 D460Y probably benign Het
Lrfn2 G A 17: 49,097,000 G717D probably benign Het
Lrp3 C T 7: 35,202,306 D696N probably benign Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr586 T C 7: 103,122,356 T143A probably damaging Het
Rad17 A T 13: 100,619,136 I579N probably damaging Het
Rif1 T A 2: 52,119,156 Y2316N probably damaging Het
Ros1 T A 10: 52,155,255 D430V probably damaging Het
Rp9 A T 9: 22,449,858 H44Q probably damaging Het
Rtl1 T C 12: 109,592,301 T1035A possibly damaging Het
Slc2a5 A C 4: 150,139,526 D225A possibly damaging Het
Tlx3 A T 11: 33,202,567 V176E possibly damaging Het
Trpv3 G A 11: 73,283,863 G352D probably damaging Het
Ubr4 C A 4: 139,429,539 H2292N possibly damaging Het
Wee2 A G 6: 40,444,255 H93R probably benign Het
Xirp2 T G 2: 67,511,650 L1412V possibly damaging Het
Zfat T C 15: 68,180,982 H321R probably damaging Het
Zfp623 C A 15: 75,947,988 C264* probably null Het
Zfp687 G C 3: 95,011,877 P195A probably benign Het
Other mutations in Crtc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Crtc1 APN 8 70439522 missense probably benign 0.01
IGL01361:Crtc1 APN 8 70387603 missense probably damaging 1.00
IGL02883:Crtc1 APN 8 70406125 missense probably benign 0.28
R0049:Crtc1 UTSW 8 70391859 critical splice donor site probably null
R0196:Crtc1 UTSW 8 70386221 missense probably damaging 1.00
R0514:Crtc1 UTSW 8 70402429 critical splice donor site probably null
R0588:Crtc1 UTSW 8 70439549 missense probably damaging 0.99
R0744:Crtc1 UTSW 8 70393013 missense probably benign 0.00
R0833:Crtc1 UTSW 8 70393013 missense probably benign 0.00
R0836:Crtc1 UTSW 8 70393013 missense probably benign 0.00
R0905:Crtc1 UTSW 8 70391255 missense probably damaging 1.00
R1016:Crtc1 UTSW 8 70392119 nonsense probably null
R1300:Crtc1 UTSW 8 70387539 critical splice donor site probably null
R1533:Crtc1 UTSW 8 70398299 missense probably damaging 1.00
R1843:Crtc1 UTSW 8 70388152 missense probably benign 0.00
R2393:Crtc1 UTSW 8 70388158 missense probably benign
R4867:Crtc1 UTSW 8 70402514 missense probably damaging 1.00
R5339:Crtc1 UTSW 8 70397733 splice site probably benign
R6062:Crtc1 UTSW 8 70406189 missense probably damaging 1.00
R6912:Crtc1 UTSW 8 70398311 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAAGTCCAAAGAGCAATCTCG -3'
(R):5'- ACTCAAGTCCCTCGCTGATG -3'

Sequencing Primer
(F):5'- AGCAATCTCGCGAGCAG -3'
(R):5'- AGGCGTGTTCACCCCAAC -3'
Posted On2018-04-27