Incidental Mutation 'R6342:Rp9'
ID513921
Institutional Source Beutler Lab
Gene Symbol Rp9
Ensembl Gene ENSMUSG00000032239
Gene Nameretinitis pigmentosa 9 (human)
SynonymsRp9h, PAP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6342 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location22411047-22469743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22449858 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 44 (H44Q)
Ref Sequence ENSEMBL: ENSMUSP00000150554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034763] [ENSMUST00000168332] [ENSMUST00000215715] [ENSMUST00000216973]
Predicted Effect probably damaging
Transcript: ENSMUST00000034763
AA Change: H129Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034763
Gene: ENSMUSG00000032239
AA Change: H129Q

DomainStartEndE-ValueType
low complexity region 19 28 N/A INTRINSIC
ZnF_C2HC 96 114 5.17e0 SMART
low complexity region 161 213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168332
Predicted Effect possibly damaging
Transcript: ENSMUST00000215715
AA Change: H129Q

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000216973
AA Change: H44Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217370
Meta Mutation Damage Score 0.1398 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can be bound and phosphorylated by the protooncogene PIM1 product, a serine/threonine protein kinase . This protein localizes in nuclear speckles containing the splicing factors, and has a role in pre-mRNA splicing. CBF1-interacting protein (CIR), a corepressor of CBF1, can also bind to this protein and effects alternative splicing. Mutations in this gene result in autosomal dominant retinitis pigmentosa-9. This gene has a pseudogene (GeneID: 441212), which is located in tandem array approximately 166 kb distal to this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa9 T C 3: 95,296,790 *346W probably null Het
Ap4b1 T C 3: 103,813,368 V118A possibly damaging Het
Atrnl1 T C 19: 57,638,510 S183P probably damaging Het
Cadm3 T C 1: 173,341,108 T298A possibly damaging Het
Crtc1 A C 8: 70,439,557 M1R probably null Het
Dalrd3 A T 9: 108,571,123 K291* probably null Het
Dhrs9 C T 2: 69,393,187 T93M probably benign Het
Dnmt1 G T 9: 20,909,793 S1267* probably null Het
Dsg1b T C 18: 20,390,243 I109T probably damaging Het
Epha3 C A 16: 63,583,500 R745L probably damaging Het
Evi2 A G 11: 79,515,958 S264P probably benign Het
Grin2a A T 16: 9,579,334 L963Q probably damaging Het
Klhdc7a T A 4: 139,967,059 R192S probably benign Het
Kynu G T 2: 43,681,451 D460Y probably benign Het
Lrfn2 G A 17: 49,097,000 G717D probably benign Het
Lrp3 C T 7: 35,202,306 D696N probably benign Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr586 T C 7: 103,122,356 T143A probably damaging Het
Rad17 A T 13: 100,619,136 I579N probably damaging Het
Rif1 T A 2: 52,119,156 Y2316N probably damaging Het
Ros1 T A 10: 52,155,255 D430V probably damaging Het
Rtl1 T C 12: 109,592,301 T1035A possibly damaging Het
Slc2a5 A C 4: 150,139,526 D225A possibly damaging Het
Tlx3 A T 11: 33,202,567 V176E possibly damaging Het
Trpv3 G A 11: 73,283,863 G352D probably damaging Het
Ubr4 C A 4: 139,429,539 H2292N possibly damaging Het
Wee2 A G 6: 40,444,255 H93R probably benign Het
Xirp2 T G 2: 67,511,650 L1412V possibly damaging Het
Zfat T C 15: 68,180,982 H321R probably damaging Het
Zfp623 C A 15: 75,947,988 C264* probably null Het
Zfp687 G C 3: 95,011,877 P195A probably benign Het
Other mutations in Rp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03210:Rp9 APN 9 22457428 missense probably benign 0.40
R0512:Rp9 UTSW 9 22458719 missense probably benign 0.00
R1157:Rp9 UTSW 9 22458740 missense probably damaging 1.00
R1500:Rp9 UTSW 9 22457455 missense probably damaging 1.00
R1677:Rp9 UTSW 9 22453801 missense probably damaging 0.99
R2135:Rp9 UTSW 9 22468129 missense possibly damaging 0.68
R3944:Rp9 UTSW 9 22449858 missense probably damaging 1.00
R5747:Rp9 UTSW 9 22448664 intron probably benign
R5853:Rp9 UTSW 9 22448769 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTCAGACTTCAAGAGGACATTGG -3'
(R):5'- TCTATCATCAAGCTACAGGAAGC -3'

Sequencing Primer
(F):5'- CAGCCTAGTCTACAGAGTGAGTTC -3'
(R):5'- GAGCTCCATTGCCAGTTTGAAGC -3'
Posted On2018-04-27