Incidental Mutation 'R6342:Dalrd3'
ID513922
Institutional Source Beutler Lab
Gene Symbol Dalrd3
Ensembl Gene ENSMUSG00000019039
Gene NameDALR anticodon binding domain containing 3
Synonyms6330580J24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6342 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108569886-108572774 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 108571123 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 291 (K291*)
Ref Sequence ENSEMBL: ENSMUSP00000019183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019183] [ENSMUST00000068700] [ENSMUST00000074208] [ENSMUST00000193427] [ENSMUST00000194381] [ENSMUST00000195249]
Predicted Effect probably null
Transcript: ENSMUST00000019183
AA Change: K291*
SMART Domains Protein: ENSMUSP00000019183
Gene: ENSMUSG00000019039
AA Change: K291*

DomainStartEndE-ValueType
low complexity region 288 301 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
DALR_1 399 538 2.09e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068700
SMART Domains Protein: ENSMUSP00000070927
Gene: ENSMUSG00000066357

DomainStartEndE-ValueType
Blast:WD40 109 142 3e-6 BLAST
WD40 198 237 1.42e-4 SMART
WD40 247 284 7.28e-2 SMART
WD40 286 326 1.72e-3 SMART
Blast:WD40 336 375 3e-13 BLAST
WD40 479 519 2.96e1 SMART
low complexity region 537 552 N/A INTRINSIC
WD40 559 598 1.77e2 SMART
Blast:WD40 600 641 7e-20 BLAST
Blast:WD40 764 815 2e-22 BLAST
Blast:WD40 855 896 2e-11 BLAST
WD40 900 949 1.48e1 SMART
WD40 973 1015 5.52e-2 SMART
WD40 1035 1076 3.98e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074208
SMART Domains Protein: ENSMUSP00000073832
Gene: ENSMUSG00000070283

DomainStartEndE-ValueType
Pfam:DUF498 61 169 9.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191897
Predicted Effect probably benign
Transcript: ENSMUST00000192518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193242
Predicted Effect probably benign
Transcript: ENSMUST00000193427
SMART Domains Protein: ENSMUSP00000141748
Gene: ENSMUSG00000019039

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
DALR_1 68 171 1.3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194104
Predicted Effect probably benign
Transcript: ENSMUST00000194381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194666
Predicted Effect probably benign
Transcript: ENSMUST00000195249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196210
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The exact function of this gene is not known. It encodes a protein with a DALR anticodon binding domain similar to that of class Ia aminoacyl tRNA synthetases. This gene is located in a cluster of genes (with a complex sense-anti-sense genome architecture) on chromosome 3, and contains two micro RNA (miRNA) precursors (mir-425 and mir-191) in one of its introns. Preferential expression of this gene (the miRNAs and other genes in the cluster) in testis suggests a role of this gene in spermatogenesis (PMID:19906709). [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa9 T C 3: 95,296,790 *346W probably null Het
Ap4b1 T C 3: 103,813,368 V118A possibly damaging Het
Atrnl1 T C 19: 57,638,510 S183P probably damaging Het
Cadm3 T C 1: 173,341,108 T298A possibly damaging Het
Crtc1 A C 8: 70,439,557 M1R probably null Het
Dhrs9 C T 2: 69,393,187 T93M probably benign Het
Dnmt1 G T 9: 20,909,793 S1267* probably null Het
Dsg1b T C 18: 20,390,243 I109T probably damaging Het
Epha3 C A 16: 63,583,500 R745L probably damaging Het
Evi2 A G 11: 79,515,958 S264P probably benign Het
Grin2a A T 16: 9,579,334 L963Q probably damaging Het
Klhdc7a T A 4: 139,967,059 R192S probably benign Het
Kynu G T 2: 43,681,451 D460Y probably benign Het
Lrfn2 G A 17: 49,097,000 G717D probably benign Het
Lrp3 C T 7: 35,202,306 D696N probably benign Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr586 T C 7: 103,122,356 T143A probably damaging Het
Rad17 A T 13: 100,619,136 I579N probably damaging Het
Rif1 T A 2: 52,119,156 Y2316N probably damaging Het
Ros1 T A 10: 52,155,255 D430V probably damaging Het
Rp9 A T 9: 22,449,858 H44Q probably damaging Het
Rtl1 T C 12: 109,592,301 T1035A possibly damaging Het
Slc2a5 A C 4: 150,139,526 D225A possibly damaging Het
Tlx3 A T 11: 33,202,567 V176E possibly damaging Het
Trpv3 G A 11: 73,283,863 G352D probably damaging Het
Ubr4 C A 4: 139,429,539 H2292N possibly damaging Het
Wee2 A G 6: 40,444,255 H93R probably benign Het
Xirp2 T G 2: 67,511,650 L1412V possibly damaging Het
Zfat T C 15: 68,180,982 H321R probably damaging Het
Zfp623 C A 15: 75,947,988 C264* probably null Het
Zfp687 G C 3: 95,011,877 P195A probably benign Het
Other mutations in Dalrd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02441:Dalrd3 APN 9 108571526 unclassified probably benign
IGL02699:Dalrd3 APN 9 108570889 splice site probably benign
IGL02701:Dalrd3 APN 9 108572284 missense possibly damaging 0.95
R0051:Dalrd3 UTSW 9 108572215 missense possibly damaging 0.89
R0051:Dalrd3 UTSW 9 108572215 missense possibly damaging 0.89
R2025:Dalrd3 UTSW 9 108571085 missense probably benign 0.08
R4425:Dalrd3 UTSW 9 108571601 unclassified probably benign
R4552:Dalrd3 UTSW 9 108572230 missense possibly damaging 0.67
R4660:Dalrd3 UTSW 9 108570369 missense probably benign
R4876:Dalrd3 UTSW 9 108571436 splice site probably benign
R5642:Dalrd3 UTSW 9 108572290 missense probably damaging 1.00
R5854:Dalrd3 UTSW 9 108570077 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGAAGATGTGCTCTCTGTGC -3'
(R):5'- ACTACATAGTCACAGGACATTTGC -3'

Sequencing Primer
(F):5'- AAGATGTGCTCTCTGTGCTCTCG -3'
(R):5'- CAGGACATTTGCACTTGTAGCACG -3'
Posted On2018-04-27