Incidental Mutation 'R6342:Evi2'
ID513926
Institutional Source Beutler Lab
Gene Symbol Evi2
Ensembl Gene ENSMUSG00000070354
Gene Nameecotropic viral integration site 2
SynonymsGm21975
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6342 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location79513385-79530589 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79515958 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 264 (S264P)
Ref Sequence ENSEMBL: ENSMUSP00000136153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000093983] [ENSMUST00000108251] [ENSMUST00000170422] [ENSMUST00000179322]
Predicted Effect probably benign
Transcript: ENSMUST00000071325
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093983
SMART Domains Protein: ENSMUSP00000091519
Gene: ENSMUSG00000070354

DomainStartEndE-ValueType
Pfam:EVI2A 1 75 1.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108251
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170422
AA Change: S264P

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000128569
Gene: ENSMUSG00000070354
AA Change: S264P

DomainStartEndE-ValueType
low complexity region 139 152 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 391 396 N/A INTRINSIC
low complexity region 425 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179322
AA Change: S264P

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000136153
Gene: ENSMUSG00000093938
AA Change: S264P

DomainStartEndE-ValueType
low complexity region 139 152 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 391 396 N/A INTRINSIC
low complexity region 425 444 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: This locus represents naturally occurring readthrough transcription between the neighboring Evi2a (ecotropic viral integration site 2a) and Evi2b (ecotropic viral integration site 2b) genes on chromosome 11. The readthrough transcript encodes a protein identical to that of the downstream gene product. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa9 T C 3: 95,296,790 *346W probably null Het
Ap4b1 T C 3: 103,813,368 V118A possibly damaging Het
Atrnl1 T C 19: 57,638,510 S183P probably damaging Het
Cadm3 T C 1: 173,341,108 T298A possibly damaging Het
Crtc1 A C 8: 70,439,557 M1R probably null Het
Dalrd3 A T 9: 108,571,123 K291* probably null Het
Dhrs9 C T 2: 69,393,187 T93M probably benign Het
Dnmt1 G T 9: 20,909,793 S1267* probably null Het
Dsg1b T C 18: 20,390,243 I109T probably damaging Het
Epha3 C A 16: 63,583,500 R745L probably damaging Het
Grin2a A T 16: 9,579,334 L963Q probably damaging Het
Klhdc7a T A 4: 139,967,059 R192S probably benign Het
Kynu G T 2: 43,681,451 D460Y probably benign Het
Lrfn2 G A 17: 49,097,000 G717D probably benign Het
Lrp3 C T 7: 35,202,306 D696N probably benign Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr586 T C 7: 103,122,356 T143A probably damaging Het
Rad17 A T 13: 100,619,136 I579N probably damaging Het
Rif1 T A 2: 52,119,156 Y2316N probably damaging Het
Ros1 T A 10: 52,155,255 D430V probably damaging Het
Rp9 A T 9: 22,449,858 H44Q probably damaging Het
Rtl1 T C 12: 109,592,301 T1035A possibly damaging Het
Slc2a5 A C 4: 150,139,526 D225A possibly damaging Het
Tlx3 A T 11: 33,202,567 V176E possibly damaging Het
Trpv3 G A 11: 73,283,863 G352D probably damaging Het
Ubr4 C A 4: 139,429,539 H2292N possibly damaging Het
Wee2 A G 6: 40,444,255 H93R probably benign Het
Xirp2 T G 2: 67,511,650 L1412V possibly damaging Het
Zfat T C 15: 68,180,982 H321R probably damaging Het
Zfp623 C A 15: 75,947,988 C264* probably null Het
Zfp687 G C 3: 95,011,877 P195A probably benign Het
Other mutations in Evi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1540:Evi2 UTSW 11 79515586 missense probably benign 0.05
R1570:Evi2 UTSW 11 79516250 missense possibly damaging 0.55
R3862:Evi2 UTSW 11 79515646 missense probably benign 0.01
R3863:Evi2 UTSW 11 79515646 missense probably benign 0.01
R3864:Evi2 UTSW 11 79515646 missense probably benign 0.01
R4427:Evi2 UTSW 11 79516356 missense possibly damaging 0.73
R4796:Evi2 UTSW 11 79515447 intron probably benign
R7391:Evi2 UTSW 11 79515667 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATCAGCACTGTCTTCTGATAAGC -3'
(R):5'- AGTGGCAAAGGAACTGCTC -3'

Sequencing Primer
(F):5'- CATTATCAGTCTTGAGGTTGC -3'
(R):5'- GCAATTGCTGCCATATTAATCGG -3'
Posted On2018-04-27