Incidental Mutation 'R6342:Rad17'
ID513928
Institutional Source Beutler Lab
Gene Symbol Rad17
Ensembl Gene ENSMUSG00000021635
Gene NameRAD17 checkpoint clamp loader component
SynonymsMmRad24, 9430035O09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6342 (G1)
Quality Score224.009
Status Validated
Chromosome13
Chromosomal Location100617164-100651051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100619136 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 579 (I579N)
Ref Sequence ENSEMBL: ENSMUSP00000136292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022136] [ENSMUST00000022137] [ENSMUST00000163163] [ENSMUST00000168772] [ENSMUST00000177848] [ENSMUST00000225754] [ENSMUST00000226050]
Predicted Effect probably damaging
Transcript: ENSMUST00000022136
AA Change: I579N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022136
Gene: ENSMUSG00000021635
AA Change: I579N

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
AAA 128 280 1.1e-4 SMART
low complexity region 342 355 N/A INTRINSIC
low complexity region 552 567 N/A INTRINSIC
low complexity region 619 635 N/A INTRINSIC
low complexity region 669 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000022137
SMART Domains Protein: ENSMUSP00000022137
Gene: ENSMUSG00000021636

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
Pfam:MARVEL 182 358 4.1e-20 PFAM
low complexity region 423 434 N/A INTRINSIC
Pfam:Occludin_ELL 443 545 2.7e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163163
SMART Domains Protein: ENSMUSP00000129990
Gene: ENSMUSG00000021636

DomainStartEndE-ValueType
low complexity region 25 53 N/A INTRINSIC
low complexity region 146 157 N/A INTRINSIC
Pfam:Occludin_ELL 166 268 4.2e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168772
SMART Domains Protein: ENSMUSP00000126438
Gene: ENSMUSG00000021636

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
Pfam:MARVEL 182 358 3.6e-20 PFAM
low complexity region 423 434 N/A INTRINSIC
Pfam:Occludin_ELL 443 545 6.6e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177848
AA Change: I579N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136292
Gene: ENSMUSG00000021635
AA Change: I579N

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
AAA 128 280 1.1e-4 SMART
low complexity region 342 355 N/A INTRINSIC
low complexity region 552 567 N/A INTRINSIC
low complexity region 619 635 N/A INTRINSIC
low complexity region 669 687 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225428
Predicted Effect probably benign
Transcript: ENSMUST00000225754
Predicted Effect probably benign
Transcript: ENSMUST00000226050
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad17, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This protein shares strong similarity with DNA replication factor C (RFC), and can form a complex with RFCs. This protein binds to chromatin prior to DNA damage and is phosphorylated by the checkpoint kinase ATR following damage. This protein recruits the RAD1-RAD9-HUS1 checkpoint protein complex onto chromatin after DNA damage, which may be required for its phosphorylation. The phosphorylation of this protein is required for the DNA-damage-induced cell cycle G2 arrest, and is thought to be a critical early event during checkpoint signaling in DNA-damaged cells. Multiple alternatively spliced transcript variants of this gene, which encode four distinct protein isoforms, have been reported. Two pseudogenes, located on chromosomes 7 and 13, have been identified. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with incomplete somite formation, abnormal bracnchial arch, liver, and heart morphology, abnormal neural tube development, and multiple hemorrhages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa9 T C 3: 95,296,790 *346W probably null Het
Ap4b1 T C 3: 103,813,368 V118A possibly damaging Het
Atrnl1 T C 19: 57,638,510 S183P probably damaging Het
Cadm3 T C 1: 173,341,108 T298A possibly damaging Het
Crtc1 A C 8: 70,439,557 M1R probably null Het
Dalrd3 A T 9: 108,571,123 K291* probably null Het
Dhrs9 C T 2: 69,393,187 T93M probably benign Het
Dnmt1 G T 9: 20,909,793 S1267* probably null Het
Dsg1b T C 18: 20,390,243 I109T probably damaging Het
Epha3 C A 16: 63,583,500 R745L probably damaging Het
Evi2 A G 11: 79,515,958 S264P probably benign Het
Grin2a A T 16: 9,579,334 L963Q probably damaging Het
Klhdc7a T A 4: 139,967,059 R192S probably benign Het
Kynu G T 2: 43,681,451 D460Y probably benign Het
Lrfn2 G A 17: 49,097,000 G717D probably benign Het
Lrp3 C T 7: 35,202,306 D696N probably benign Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr586 T C 7: 103,122,356 T143A probably damaging Het
Rif1 T A 2: 52,119,156 Y2316N probably damaging Het
Ros1 T A 10: 52,155,255 D430V probably damaging Het
Rp9 A T 9: 22,449,858 H44Q probably damaging Het
Rtl1 T C 12: 109,592,301 T1035A possibly damaging Het
Slc2a5 A C 4: 150,139,526 D225A possibly damaging Het
Tlx3 A T 11: 33,202,567 V176E possibly damaging Het
Trpv3 G A 11: 73,283,863 G352D probably damaging Het
Ubr4 C A 4: 139,429,539 H2292N possibly damaging Het
Wee2 A G 6: 40,444,255 H93R probably benign Het
Xirp2 T G 2: 67,511,650 L1412V possibly damaging Het
Zfat T C 15: 68,180,982 H321R probably damaging Het
Zfp623 C A 15: 75,947,988 C264* probably null Het
Zfp687 G C 3: 95,011,877 P195A probably benign Het
Other mutations in Rad17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Rad17 APN 13 100629525 missense probably benign 0.03
IGL00422:Rad17 APN 13 100629523 missense probably damaging 0.98
IGL00478:Rad17 APN 13 100633274 missense probably damaging 1.00
IGL01328:Rad17 APN 13 100617803 missense probably benign
IGL01720:Rad17 APN 13 100622858 missense possibly damaging 0.51
IGL01874:Rad17 APN 13 100617684 utr 3 prime probably benign
IGL02305:Rad17 APN 13 100633862 critical splice donor site probably null
IGL02541:Rad17 APN 13 100633443 splice site probably benign
R0678:Rad17 UTSW 13 100645184 missense possibly damaging 0.73
R1079:Rad17 UTSW 13 100633899 missense probably benign 0.01
R1422:Rad17 UTSW 13 100645082 missense probably benign 0.18
R1730:Rad17 UTSW 13 100622806 missense probably damaging 0.97
R3946:Rad17 UTSW 13 100622863 missense possibly damaging 0.70
R4577:Rad17 UTSW 13 100633278 missense probably damaging 1.00
R4735:Rad17 UTSW 13 100619129 missense probably damaging 0.98
R5023:Rad17 UTSW 13 100645063 missense possibly damaging 0.88
R5098:Rad17 UTSW 13 100617646 makesense probably null
R5222:Rad17 UTSW 13 100633891 missense possibly damaging 0.53
R5511:Rad17 UTSW 13 100627649 missense possibly damaging 0.82
R5536:Rad17 UTSW 13 100631104 missense probably damaging 1.00
R5887:Rad17 UTSW 13 100633861 critical splice donor site probably null
R6041:Rad17 UTSW 13 100617766 missense probably benign 0.01
R6173:Rad17 UTSW 13 100622881 missense probably benign
R6465:Rad17 UTSW 13 100637080 missense probably benign 0.34
R6730:Rad17 UTSW 13 100649745 start gained probably benign
R6890:Rad17 UTSW 13 100637084 missense probably benign 0.34
R6947:Rad17 UTSW 13 100622875 missense probably damaging 1.00
R7035:Rad17 UTSW 13 100627625 missense possibly damaging 0.78
R7113:Rad17 UTSW 13 100629517 missense probably benign 0.03
R7408:Rad17 UTSW 13 100629511 nonsense probably null
R7553:Rad17 UTSW 13 100633286 missense probably damaging 1.00
R7573:Rad17 UTSW 13 100629466 missense probably damaging 0.99
RF022:Rad17 UTSW 13 100637085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTAGACAGCCTAGCTTGAGTT -3'
(R):5'- TTAAGGGCTGGAGAGATGGC -3'

Sequencing Primer
(F):5'- CAGCCTAGCTTGAGTTATAAGGC -3'
(R):5'- CTCAGCGGTTAAAAGCACTGACTG -3'
Posted On2018-04-27