Incidental Mutation 'R6342:Zfp623'
ID 513930
Institutional Source Beutler Lab
Gene Symbol Zfp623
Ensembl Gene ENSMUSG00000050846
Gene Name zinc finger protein 623
Synonyms 2610029D06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.446) question?
Stock # R6342 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 75940952-75949400 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 75947988 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 264 (C264*)
Ref Sequence ENSEMBL: ENSMUSP00000036049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037260]
AlphaFold Q9CY99
Predicted Effect probably null
Transcript: ENSMUST00000037260
AA Change: C264*
SMART Domains Protein: ENSMUSP00000036049
Gene: ENSMUSG00000050846
AA Change: C264*

DomainStartEndE-ValueType
ZnF_C2H2 119 141 5.59e-4 SMART
ZnF_C2H2 147 169 9.96e-1 SMART
ZnF_C2H2 175 197 2.4e-3 SMART
ZnF_C2H2 203 225 6.42e-4 SMART
ZnF_C2H2 231 253 1.3e-4 SMART
ZnF_C2H2 259 281 1.3e-4 SMART
ZnF_C2H2 287 309 1.28e-3 SMART
ZnF_C2H2 315 337 3.21e-4 SMART
ZnF_C2H2 343 365 3.39e-3 SMART
ZnF_C2H2 371 393 4.87e-4 SMART
ZnF_C2H2 399 421 2.53e-2 SMART
ZnF_C2H2 427 449 3.95e-4 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa9 T C 3: 95,296,790 *346W probably null Het
Ap4b1 T C 3: 103,813,368 V118A possibly damaging Het
Atrnl1 T C 19: 57,638,510 S183P probably damaging Het
Cadm3 T C 1: 173,341,108 T298A possibly damaging Het
Crtc1 A C 8: 70,439,557 M1R probably null Het
Dalrd3 A T 9: 108,571,123 K291* probably null Het
Dhrs9 C T 2: 69,393,187 T93M probably benign Het
Dnmt1 G T 9: 20,909,793 S1267* probably null Het
Dsg1b T C 18: 20,390,243 I109T probably damaging Het
Epha3 C A 16: 63,583,500 R745L probably damaging Het
Evi2 A G 11: 79,515,958 S264P probably benign Het
Grin2a A T 16: 9,579,334 L963Q probably damaging Het
Klhdc7a T A 4: 139,967,059 R192S probably benign Het
Kynu G T 2: 43,681,451 D460Y probably benign Het
Lrfn2 G A 17: 49,097,000 G717D probably benign Het
Lrp3 C T 7: 35,202,306 D696N probably benign Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr586 T C 7: 103,122,356 T143A probably damaging Het
Rad17 A T 13: 100,619,136 I579N probably damaging Het
Rif1 T A 2: 52,119,156 Y2316N probably damaging Het
Ros1 T A 10: 52,155,255 D430V probably damaging Het
Rp9 A T 9: 22,449,858 H44Q probably damaging Het
Rtl1 T C 12: 109,592,301 T1035A possibly damaging Het
Slc2a5 A C 4: 150,139,526 D225A possibly damaging Het
Tlx3 A T 11: 33,202,567 V176E possibly damaging Het
Trpv3 G A 11: 73,283,863 G352D probably damaging Het
Ubr4 C A 4: 139,429,539 H2292N possibly damaging Het
Wee2 A G 6: 40,444,255 H93R probably benign Het
Xirp2 T G 2: 67,511,650 L1412V possibly damaging Het
Zfat T C 15: 68,180,982 H321R probably damaging Het
Zfp687 G C 3: 95,011,877 P195A probably benign Het
Other mutations in Zfp623
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Zfp623 APN 15 75948203 missense probably damaging 1.00
IGL01524:Zfp623 APN 15 75947679 missense probably benign
IGL01927:Zfp623 APN 15 75947505 missense possibly damaging 0.57
IGL03199:Zfp623 APN 15 75947270 missense probably benign 0.40
R0076:Zfp623 UTSW 15 75947209 missense probably benign
R0352:Zfp623 UTSW 15 75948584 missense probably benign 0.00
R0360:Zfp623 UTSW 15 75948661 missense probably benign
R0364:Zfp623 UTSW 15 75948661 missense probably benign
R1783:Zfp623 UTSW 15 75947911 missense probably damaging 0.99
R2219:Zfp623 UTSW 15 75947530 missense possibly damaging 0.90
R5975:Zfp623 UTSW 15 75948163 missense probably benign 0.43
R6161:Zfp623 UTSW 15 75948621 missense probably benign 0.22
R6490:Zfp623 UTSW 15 75948459 missense probably damaging 1.00
R6513:Zfp623 UTSW 15 75947468 missense probably benign
R7028:Zfp623 UTSW 15 75948305 missense probably damaging 0.99
R7399:Zfp623 UTSW 15 75947398 missense probably damaging 0.98
R7716:Zfp623 UTSW 15 75948422 missense probably damaging 1.00
R8362:Zfp623 UTSW 15 75947639 missense probably damaging 1.00
R8445:Zfp623 UTSW 15 75947553 nonsense probably null
R9028:Zfp623 UTSW 15 75947500 missense probably damaging 0.97
R9035:Zfp623 UTSW 15 75948313 missense possibly damaging 0.93
R9310:Zfp623 UTSW 15 75948100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGTTCAGACCTGCTTCG -3'
(R):5'- AACGCTTCCCACACTCGTTG -3'

Sequencing Primer
(F):5'- CATACCAGGGAGAGGCCTTTTG -3'
(R):5'- TTGCACACGTAAGGCCG -3'
Posted On 2018-04-27