Incidental Mutation 'R6346:Helz2'
ID 513943
Institutional Source Beutler Lab
Gene Symbol Helz2
Ensembl Gene ENSMUSG00000027580
Gene Name helicase with zinc finger 2, transcriptional coactivator
Synonyms BC006779
MMRRC Submission 044500-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6346 (G1)
Quality Score 218.009
Status Validated
Chromosome 2
Chromosomal Location 180869408-180883820 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 180875260 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1745 (E1745K)
Ref Sequence ENSEMBL: ENSMUSP00000091756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094203] [ENSMUST00000108831] [ENSMUST00000121484]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000094203
AA Change: E1745K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091756
Gene: ENSMUSG00000027580
AA Change: E1745K

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108831
AA Change: E1745K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104459
Gene: ENSMUSG00000027580
AA Change: E1745K

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121484
AA Change: E1745K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112917
Gene: ENSMUSG00000027580
AA Change: E1745K

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
Pfam:AAA_11 761 877 3.9e-10 PFAM
Pfam:AAA_19 780 849 1.7e-7 PFAM
Pfam:AAA_11 870 952 2e-15 PFAM
Pfam:AAA_12 958 1162 3.8e-26 PFAM
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
Pfam:AAA_11 2400 2653 4e-42 PFAM
Pfam:AAA_12 2660 2866 2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155049
Meta Mutation Damage Score 0.6039 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear transcriptional co-activator for peroxisome proliferator activated receptor alpha. The encoded protein contains a zinc finger and is a helicase that appears to be part of the peroxisome proliferator activated receptor alpha interacting complex. This gene is a member of the DNA2/NAM7 helicase gene family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slower weight gain, hyperleptinemia, increased oxygen consumption, decreased respiratory quotient, decreased liver triglyceride level and ameliorated hyperlipidemia and hepatosteatosis when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 C T 7: 75,335,002 (GRCm39) S455L probably damaging Het
Apbb1ip T G 2: 22,757,005 (GRCm39) probably null Het
Arhgap18 A T 10: 26,722,061 (GRCm39) I11F probably damaging Het
Arl14epl A T 18: 47,059,409 (GRCm39) N8I possibly damaging Het
Atp4a T A 7: 30,414,781 (GRCm39) I190N possibly damaging Het
Bfar T C 16: 13,519,997 (GRCm39) F285S probably damaging Het
Carf C T 1: 60,180,699 (GRCm39) Q409* probably null Het
Cd244a T C 1: 171,404,889 (GRCm39) V247A probably damaging Het
Ceacam12 T A 7: 17,803,326 (GRCm39) I244K probably damaging Het
Cmya5 T C 13: 93,228,698 (GRCm39) E2130G probably damaging Het
Cyp2b23 T G 7: 26,381,150 (GRCm39) H69P probably damaging Het
Dixdc1 T C 9: 50,595,253 (GRCm39) Q183R probably damaging Het
Dock10 T A 1: 80,553,573 (GRCm39) probably null Het
Fam20c T C 5: 138,752,450 (GRCm39) F279S probably damaging Het
Hcn4 C T 9: 58,766,327 (GRCm39) T665I unknown Het
Kdm7a A T 6: 39,128,145 (GRCm39) probably null Het
Ksr1 A C 11: 78,910,490 (GRCm39) L814R possibly damaging Het
Lmnb1 A G 18: 56,876,310 (GRCm39) I473V probably benign Het
Mllt3 T C 4: 87,759,445 (GRCm39) K201R probably damaging Het
Myo1b C T 1: 51,823,666 (GRCm39) C413Y probably damaging Het
Myom3 A T 4: 135,533,362 (GRCm39) N1185I probably benign Het
Nrde2 A G 12: 100,098,565 (GRCm39) S701P probably benign Het
Ntn4 A T 10: 93,480,723 (GRCm39) D112V probably damaging Het
Nup43 T A 10: 7,550,826 (GRCm39) V232D probably damaging Het
Pcdha6 G A 18: 37,101,113 (GRCm39) C102Y probably damaging Het
Pcdhgb8 T C 18: 37,895,131 (GRCm39) L67P probably damaging Het
Pkd1l3 A G 8: 110,358,016 (GRCm39) H836R probably damaging Het
Plekha1 T A 7: 130,479,512 (GRCm39) I10N probably benign Het
Prss29 A G 17: 25,540,084 (GRCm39) T161A possibly damaging Het
Psmb5 C A 14: 54,854,130 (GRCm39) R116L probably damaging Het
Rsf1 A AGGGCGACGG 7: 97,229,111 (GRCm39) probably null Het
Secisbp2 C T 13: 51,833,923 (GRCm39) H688Y probably damaging Het
Senp5 A G 16: 31,802,665 (GRCm39) Y508H probably damaging Het
Shc3 T A 13: 51,605,651 (GRCm39) T210S possibly damaging Het
Slc27a2 G A 2: 126,429,800 (GRCm39) V467M probably damaging Het
Slc27a5 T A 7: 12,724,899 (GRCm39) E487V possibly damaging Het
Snx1 T C 9: 66,001,930 (GRCm39) T298A possibly damaging Het
Trir A G 8: 85,753,643 (GRCm39) D39G possibly damaging Het
Ubd C T 17: 37,506,242 (GRCm39) Q43* probably null Het
Ube2o T C 11: 116,432,194 (GRCm39) E924G probably damaging Het
Vps13a T C 19: 16,659,578 (GRCm39) I1650V possibly damaging Het
Xirp2 C A 2: 67,346,425 (GRCm39) R2889S probably benign Het
Zfp804b T C 5: 6,820,534 (GRCm39) E843G probably benign Het
Other mutations in Helz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Helz2 APN 2 180,871,495 (GRCm39) missense probably damaging 1.00
IGL00515:Helz2 APN 2 180,874,799 (GRCm39) nonsense probably null
IGL00704:Helz2 APN 2 180,876,178 (GRCm39) missense probably damaging 1.00
IGL00847:Helz2 APN 2 180,874,038 (GRCm39) missense possibly damaging 0.73
IGL01448:Helz2 APN 2 180,875,770 (GRCm39) missense probably damaging 1.00
IGL01783:Helz2 APN 2 180,874,674 (GRCm39) missense probably damaging 1.00
IGL01790:Helz2 APN 2 180,880,274 (GRCm39) missense probably benign 0.29
IGL02116:Helz2 APN 2 180,873,978 (GRCm39) missense probably damaging 1.00
IGL02226:Helz2 APN 2 180,873,483 (GRCm39) missense probably damaging 1.00
IGL02402:Helz2 APN 2 180,872,704 (GRCm39) missense probably damaging 1.00
IGL02403:Helz2 APN 2 180,872,815 (GRCm39) missense probably damaging 1.00
IGL02733:Helz2 APN 2 180,876,819 (GRCm39) missense probably benign 0.14
IGL02869:Helz2 APN 2 180,872,939 (GRCm39) intron probably benign
IGL03003:Helz2 APN 2 180,882,046 (GRCm39) missense probably damaging 1.00
IGL03060:Helz2 APN 2 180,871,015 (GRCm39) critical splice donor site probably null
IGL03310:Helz2 APN 2 180,873,597 (GRCm39) missense probably benign 0.00
Colby UTSW 2 180,874,995 (GRCm39) missense probably damaging 1.00
ANU74:Helz2 UTSW 2 180,876,627 (GRCm39) missense probably benign 0.03
R0013:Helz2 UTSW 2 180,882,752 (GRCm39) missense probably benign
R0013:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0014:Helz2 UTSW 2 180,882,304 (GRCm39) missense probably damaging 1.00
R0014:Helz2 UTSW 2 180,882,304 (GRCm39) missense probably damaging 1.00
R0016:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0018:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0019:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0019:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0055:Helz2 UTSW 2 180,870,614 (GRCm39) missense possibly damaging 0.47
R0055:Helz2 UTSW 2 180,870,614 (GRCm39) missense possibly damaging 0.47
R0071:Helz2 UTSW 2 180,878,200 (GRCm39) missense probably damaging 1.00
R0071:Helz2 UTSW 2 180,878,200 (GRCm39) missense probably damaging 1.00
R0111:Helz2 UTSW 2 180,879,595 (GRCm39) missense probably benign 0.30
R0117:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0135:Helz2 UTSW 2 180,874,062 (GRCm39) missense probably damaging 1.00
R0194:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0242:Helz2 UTSW 2 180,872,223 (GRCm39) missense probably damaging 1.00
R0242:Helz2 UTSW 2 180,872,223 (GRCm39) missense probably damaging 1.00
R0254:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0410:Helz2 UTSW 2 180,872,386 (GRCm39) missense probably damaging 1.00
R0442:Helz2 UTSW 2 180,874,002 (GRCm39) missense probably damaging 0.97
R0497:Helz2 UTSW 2 180,871,449 (GRCm39) missense probably damaging 0.97
R0517:Helz2 UTSW 2 180,869,563 (GRCm39) missense probably benign 0.00
R0541:Helz2 UTSW 2 180,876,618 (GRCm39) missense possibly damaging 0.89
R0542:Helz2 UTSW 2 180,873,882 (GRCm39) missense probably damaging 1.00
R0591:Helz2 UTSW 2 180,873,909 (GRCm39) missense probably damaging 0.96
R0692:Helz2 UTSW 2 180,882,674 (GRCm39) missense probably benign
R0826:Helz2 UTSW 2 180,882,646 (GRCm39) missense possibly damaging 0.51
R0834:Helz2 UTSW 2 180,872,570 (GRCm39) missense probably damaging 1.00
R0880:Helz2 UTSW 2 180,877,928 (GRCm39) missense probably benign
R1170:Helz2 UTSW 2 180,871,608 (GRCm39) missense probably damaging 1.00
R1186:Helz2 UTSW 2 180,872,921 (GRCm39) missense probably damaging 1.00
R1344:Helz2 UTSW 2 180,879,389 (GRCm39) missense possibly damaging 0.89
R1358:Helz2 UTSW 2 180,874,774 (GRCm39) missense probably damaging 1.00
R1436:Helz2 UTSW 2 180,877,317 (GRCm39) missense probably damaging 0.99
R1464:Helz2 UTSW 2 180,881,447 (GRCm39) missense probably damaging 1.00
R1464:Helz2 UTSW 2 180,881,447 (GRCm39) missense probably damaging 1.00
R1466:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1466:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1477:Helz2 UTSW 2 180,874,597 (GRCm39) missense probably benign 0.00
R1564:Helz2 UTSW 2 180,875,021 (GRCm39) missense probably benign 0.01
R1584:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1655:Helz2 UTSW 2 180,875,940 (GRCm39) missense probably damaging 0.99
R1757:Helz2 UTSW 2 180,878,056 (GRCm39) missense probably damaging 1.00
R1779:Helz2 UTSW 2 180,880,252 (GRCm39) missense possibly damaging 0.84
R1779:Helz2 UTSW 2 180,876,780 (GRCm39) missense probably benign
R1837:Helz2 UTSW 2 180,871,082 (GRCm39) missense probably damaging 1.00
R1845:Helz2 UTSW 2 180,873,878 (GRCm39) missense probably benign 0.02
R1894:Helz2 UTSW 2 180,876,082 (GRCm39) missense probably damaging 1.00
R1913:Helz2 UTSW 2 180,875,543 (GRCm39) missense probably damaging 1.00
R2005:Helz2 UTSW 2 180,873,122 (GRCm39) missense probably benign 0.45
R2034:Helz2 UTSW 2 180,874,371 (GRCm39) missense probably damaging 1.00
R2036:Helz2 UTSW 2 180,879,272 (GRCm39) missense probably benign 0.03
R2061:Helz2 UTSW 2 180,882,337 (GRCm39) missense probably damaging 1.00
R2088:Helz2 UTSW 2 180,876,895 (GRCm39) missense probably benign 0.07
R2142:Helz2 UTSW 2 180,873,173 (GRCm39) missense probably benign
R2180:Helz2 UTSW 2 180,875,525 (GRCm39) missense probably damaging 1.00
R2192:Helz2 UTSW 2 180,870,841 (GRCm39) nonsense probably null
R2248:Helz2 UTSW 2 180,875,226 (GRCm39) missense probably benign 0.33
R2495:Helz2 UTSW 2 180,874,705 (GRCm39) missense probably damaging 0.99
R2886:Helz2 UTSW 2 180,882,535 (GRCm39) missense probably benign
R3617:Helz2 UTSW 2 180,874,854 (GRCm39) missense probably damaging 1.00
R3776:Helz2 UTSW 2 180,882,182 (GRCm39) nonsense probably null
R3803:Helz2 UTSW 2 180,881,789 (GRCm39) missense probably damaging 0.96
R4043:Helz2 UTSW 2 180,871,503 (GRCm39) missense probably benign 0.00
R4052:Helz2 UTSW 2 180,882,268 (GRCm39) missense probably damaging 1.00
R4232:Helz2 UTSW 2 180,871,695 (GRCm39) missense probably damaging 1.00
R4521:Helz2 UTSW 2 180,870,626 (GRCm39) missense probably benign
R4624:Helz2 UTSW 2 180,881,101 (GRCm39) missense probably damaging 0.99
R4720:Helz2 UTSW 2 180,880,210 (GRCm39) missense probably damaging 1.00
R4831:Helz2 UTSW 2 180,879,210 (GRCm39) missense probably damaging 1.00
R4852:Helz2 UTSW 2 180,871,913 (GRCm39) missense probably damaging 1.00
R4894:Helz2 UTSW 2 180,877,940 (GRCm39) missense probably benign 0.01
R4915:Helz2 UTSW 2 180,874,231 (GRCm39) missense possibly damaging 0.80
R4965:Helz2 UTSW 2 180,882,709 (GRCm39) missense possibly damaging 0.79
R5022:Helz2 UTSW 2 180,882,362 (GRCm39) missense probably benign
R5089:Helz2 UTSW 2 180,876,942 (GRCm39) missense probably benign 0.14
R5190:Helz2 UTSW 2 180,872,550 (GRCm39) critical splice donor site probably null
R5309:Helz2 UTSW 2 180,876,639 (GRCm39) missense probably benign 0.08
R5358:Helz2 UTSW 2 180,877,321 (GRCm39) missense probably damaging 1.00
R5379:Helz2 UTSW 2 180,876,862 (GRCm39) missense probably benign
R5559:Helz2 UTSW 2 180,871,919 (GRCm39) missense probably damaging 0.98
R5591:Helz2 UTSW 2 180,882,051 (GRCm39) missense probably damaging 0.99
R5596:Helz2 UTSW 2 180,879,082 (GRCm39) intron probably benign
R5805:Helz2 UTSW 2 180,882,301 (GRCm39) missense probably damaging 1.00
R5823:Helz2 UTSW 2 180,878,189 (GRCm39) missense possibly damaging 0.92
R5825:Helz2 UTSW 2 180,874,449 (GRCm39) missense probably benign 0.02
R5873:Helz2 UTSW 2 180,875,821 (GRCm39) missense possibly damaging 0.78
R5928:Helz2 UTSW 2 180,872,177 (GRCm39) missense possibly damaging 0.82
R5936:Helz2 UTSW 2 180,872,560 (GRCm39) missense probably damaging 1.00
R5975:Helz2 UTSW 2 180,872,843 (GRCm39) missense probably benign 0.08
R6045:Helz2 UTSW 2 180,882,106 (GRCm39) missense probably benign 0.03
R6077:Helz2 UTSW 2 180,874,831 (GRCm39) missense probably benign 0.41
R6218:Helz2 UTSW 2 180,874,087 (GRCm39) missense probably benign 0.03
R6218:Helz2 UTSW 2 180,877,738 (GRCm39) missense probably damaging 1.00
R6315:Helz2 UTSW 2 180,874,995 (GRCm39) missense probably damaging 1.00
R6371:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6372:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6373:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6385:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6464:Helz2 UTSW 2 180,876,862 (GRCm39) missense probably benign
R6581:Helz2 UTSW 2 180,871,172 (GRCm39) missense probably damaging 0.99
R6651:Helz2 UTSW 2 180,881,350 (GRCm39) nonsense probably null
R6964:Helz2 UTSW 2 180,872,221 (GRCm39) missense probably damaging 1.00
R7061:Helz2 UTSW 2 180,882,307 (GRCm39) missense probably damaging 1.00
R7153:Helz2 UTSW 2 180,873,078 (GRCm39) missense probably benign 0.00
R7372:Helz2 UTSW 2 180,880,216 (GRCm39) missense possibly damaging 0.61
R7512:Helz2 UTSW 2 180,877,393 (GRCm39) splice site probably null
R7512:Helz2 UTSW 2 180,872,647 (GRCm39) missense probably benign 0.00
R7583:Helz2 UTSW 2 180,879,365 (GRCm39) missense probably benign 0.06
R7724:Helz2 UTSW 2 180,873,789 (GRCm39) missense probably damaging 1.00
R7733:Helz2 UTSW 2 180,872,148 (GRCm39) missense possibly damaging 0.63
R7748:Helz2 UTSW 2 180,876,324 (GRCm39) missense probably damaging 1.00
R7774:Helz2 UTSW 2 180,875,784 (GRCm39) missense probably benign
R7799:Helz2 UTSW 2 180,879,782 (GRCm39) missense probably benign 0.15
R7841:Helz2 UTSW 2 180,874,695 (GRCm39) missense probably damaging 1.00
R7939:Helz2 UTSW 2 180,879,543 (GRCm39) missense probably damaging 0.99
R8026:Helz2 UTSW 2 180,881,998 (GRCm39) missense probably benign 0.34
R8030:Helz2 UTSW 2 180,879,689 (GRCm39) missense possibly damaging 0.55
R8080:Helz2 UTSW 2 180,880,055 (GRCm39) missense probably damaging 0.99
R8237:Helz2 UTSW 2 180,871,124 (GRCm39) missense possibly damaging 0.65
R8245:Helz2 UTSW 2 180,879,895 (GRCm39) missense probably damaging 1.00
R8304:Helz2 UTSW 2 180,871,950 (GRCm39) missense probably benign 0.03
R8486:Helz2 UTSW 2 180,871,124 (GRCm39) missense probably damaging 1.00
R8556:Helz2 UTSW 2 180,871,350 (GRCm39) missense probably damaging 1.00
R8878:Helz2 UTSW 2 180,874,560 (GRCm39) missense possibly damaging 0.67
R8907:Helz2 UTSW 2 180,874,920 (GRCm39) missense possibly damaging 0.47
R8911:Helz2 UTSW 2 180,880,173 (GRCm39) missense
R8953:Helz2 UTSW 2 180,874,884 (GRCm39) missense probably damaging 1.00
R8963:Helz2 UTSW 2 180,871,407 (GRCm39) missense probably damaging 1.00
R8969:Helz2 UTSW 2 180,879,581 (GRCm39) missense probably benign 0.19
R8976:Helz2 UTSW 2 180,876,486 (GRCm39) missense possibly damaging 0.46
R9015:Helz2 UTSW 2 180,870,792 (GRCm39) missense probably damaging 1.00
R9031:Helz2 UTSW 2 180,874,261 (GRCm39) missense possibly damaging 0.78
R9052:Helz2 UTSW 2 180,881,968 (GRCm39) missense possibly damaging 0.78
R9089:Helz2 UTSW 2 180,881,433 (GRCm39) missense probably damaging 1.00
R9145:Helz2 UTSW 2 180,881,848 (GRCm39) missense probably damaging 1.00
R9185:Helz2 UTSW 2 180,871,883 (GRCm39) missense probably benign
R9186:Helz2 UTSW 2 180,876,457 (GRCm39) missense possibly damaging 0.57
R9373:Helz2 UTSW 2 180,882,741 (GRCm39) missense probably benign
R9407:Helz2 UTSW 2 180,881,975 (GRCm39) missense probably benign 0.01
R9465:Helz2 UTSW 2 180,874,710 (GRCm39) missense probably benign 0.01
R9502:Helz2 UTSW 2 180,878,245 (GRCm39) missense possibly damaging 0.47
R9538:Helz2 UTSW 2 180,882,014 (GRCm39) missense probably damaging 1.00
R9554:Helz2 UTSW 2 180,882,470 (GRCm39) missense probably damaging 0.96
R9659:Helz2 UTSW 2 180,882,025 (GRCm39) missense probably benign 0.00
R9800:Helz2 UTSW 2 180,882,616 (GRCm39) missense probably damaging 0.99
X0064:Helz2 UTSW 2 180,873,534 (GRCm39) missense probably damaging 1.00
Z1176:Helz2 UTSW 2 180,879,357 (GRCm39) missense probably benign 0.39
Z1177:Helz2 UTSW 2 180,877,754 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTCTGTACTTCTTGAAAACAC -3'
(R):5'- GATCAAGAGCCTGCGATTTGC -3'

Sequencing Primer
(F):5'- CTTGAAAACACTGTCAAGCTGCTG -3'
(R):5'- TAATCCGCTCTGACCGCCAG -3'
Posted On 2018-04-27