Mutagenetix > Incidental Mutation

Incidental Mutation 'R6346:Atp4a'

513952

Institutional Source

Beutler Lab

Gene Symbol

Atp4a

Ensembl Gene

ENSMUSG00000005553

Gene Name

ATPase, H+/K+ exchanging, gastric, alpha polypeptide

Synonyms

H+/K+-ATPase alpha, H+K+-transporting alpha 1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R6346 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30712209-30725534 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30715356 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 190 (I190N)

Ref Sequence

ENSEMBL: ENSMUSP00000131964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005692
AA Change: I190N

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: I190N

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	5.4e-23	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	144	375	1.1e-57	PFAM
Pfam:Hydrolase	380	739	5.3e-16	PFAM
Pfam:HAD	383	736	1.9e-18	PFAM
Pfam:Cation_ATPase	436	531	1.6e-24	PFAM
Pfam:Cation_ATPase_C	809	1019	4.8e-43	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167761

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170371
AA Change: I190N

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: I190N

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	4.9e-28	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	145	376	1e-62	PFAM
Pfam:Hydrolase	380	730	9.3e-25	PFAM
Pfam:HAD	383	727	2.1e-15	PFAM
Pfam:Hydrolase_like2	436	531	4e-25	PFAM
Pfam:Cation_ATPase_C	800	1010	1.5e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171014

Meta Mutation Damage Score

0.8005

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap13	C	T	7: 75,685,254	S455L	probably damaging	Het
Apbb1ip	T	G	2: 22,866,993		probably null	Het
Arhgap18	A	T	10: 26,846,065	I11F	probably damaging	Het
Arl14epl	A	T	18: 46,926,342	N8I	possibly damaging	Het
Bfar	T	C	16: 13,702,133	F285S	probably damaging	Het
Carf	C	T	1: 60,141,540	Q409*	probably null	Het
Cd244	T	C	1: 171,577,321	V247A	probably damaging	Het
Ceacam12	T	A	7: 18,069,401	I244K	probably damaging	Het
Cmya5	T	C	13: 93,092,190	E2130G	probably damaging	Het
Cyp2b23	T	G	7: 26,681,725	H69P	probably damaging	Het
Dixdc1	T	C	9: 50,683,953	Q183R	probably damaging	Het
Dock10	T	A	1: 80,575,856		probably null	Het
Fam20c	T	C	5: 138,766,695	F279S	probably damaging	Het
Hcn4	C	T	9: 58,859,044	T665I	unknown	Het
Helz2	C	T	2: 181,233,467	E1745K	probably damaging	Het
Kdm7a	A	T	6: 39,151,211		probably null	Het
Ksr1	A	C	11: 79,019,664	L814R	possibly damaging	Het
Lmnb1	A	G	18: 56,743,238	I473V	probably benign	Het
Mllt3	T	C	4: 87,841,208	K201R	probably damaging	Het
Myo1b	C	T	1: 51,784,507	C413Y	probably damaging	Het
Myom3	A	T	4: 135,806,051	N1185I	probably benign	Het
Nrde2	A	G	12: 100,132,306	S701P	probably benign	Het
Ntn4	A	T	10: 93,644,861	D112V	probably damaging	Het
Nup43	T	A	10: 7,675,062	V232D	probably damaging	Het
Pcdha6	G	A	18: 36,968,060	C102Y	probably damaging	Het
Pcdhgb8	T	C	18: 37,762,078	L67P	probably damaging	Het
Pkd1l3	A	G	8: 109,631,384	H836R	probably damaging	Het
Plekha1	T	A	7: 130,877,782	I10N	probably benign	Het
Prss29	A	G	17: 25,321,110	T161A	possibly damaging	Het
Psmb5	C	A	14: 54,616,673	R116L	probably damaging	Het
Rsf1	A	AGGGCGACGG	7: 97,579,904		probably null	Het
Secisbp2	C	T	13: 51,679,887	H688Y	probably damaging	Het
Senp5	A	G	16: 31,983,847	Y508H	probably damaging	Het
Shc3	T	A	13: 51,451,615	T210S	possibly damaging	Het
Slc27a2	G	A	2: 126,587,880	V467M	probably damaging	Het
Slc27a5	T	A	7: 12,990,972	E487V	possibly damaging	Het
Snx1	T	C	9: 66,094,648	T298A	possibly damaging	Het
Trir	A	G	8: 85,027,014	D39G	possibly damaging	Het
Ubd	C	T	17: 37,195,351	Q43*	probably null	Het
Ube2o	T	C	11: 116,541,368	E924G	probably damaging	Het
Vps13a	T	C	19: 16,682,214	I1650V	possibly damaging	Het
Xirp2	C	A	2: 67,516,081	R2889S	probably benign	Het
Zfp804b	T	C	5: 6,770,534	E843G	probably benign	Het

Other mutations in Atp4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Atp4a	APN	7	30713204	missense	possibly damaging	0.95
IGL01327:Atp4a	APN	7	30713250	missense	possibly damaging	0.96
IGL01510:Atp4a	APN	7	30720791	missense	probably benign	0.02
IGL01763:Atp4a	APN	7	30715518	missense	probably benign	0.20
IGL02061:Atp4a	APN	7	30715029	missense	probably damaging	1.00
IGL02435:Atp4a	APN	7	30717057	missense	probably benign
IGL02903:Atp4a	APN	7	30715919	missense	probably benign	0.00
IGL03181:Atp4a	APN	7	30724704	missense	probably benign	0.02
IGL03350:Atp4a	APN	7	30720867	missense	probably damaging	1.00
atypical	UTSW	7	30715356	missense	possibly damaging	0.84
sublytic	UTSW	7	30715800	missense	probably benign	0.32
IGL03097:Atp4a	UTSW	7	30723037	missense	probably benign	0.14
R0095:Atp4a	UTSW	7	30720735	missense	probably damaging	0.99
R0121:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0140:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0241:Atp4a	UTSW	7	30717135	missense	probably benign	0.00
R0437:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0624:Atp4a	UTSW	7	30718999	missense	probably benign
R1164:Atp4a	UTSW	7	30717692	missense	probably benign	0.00
R2105:Atp4a	UTSW	7	30720368	critical splice donor site	probably null
R2272:Atp4a	UTSW	7	30715500	nonsense	probably null
R2327:Atp4a	UTSW	7	30720241	missense	probably benign	0.16
R2881:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2990:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2992:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2993:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3123:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3125:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3441:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3442:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3686:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3687:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3845:Atp4a	UTSW	7	30717115	missense	probably null	0.99
R4027:Atp4a	UTSW	7	30724952	splice site	probably null
R4072:Atp4a	UTSW	7	30715332	missense	probably benign	0.09
R4433:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4454:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4457:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4458:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4510:Atp4a	UTSW	7	30724253	nonsense	probably null
R4511:Atp4a	UTSW	7	30724253	nonsense	probably null
R4576:Atp4a	UTSW	7	30717722	missense	probably benign	0.25
R4656:Atp4a	UTSW	7	30719948	intron	probably benign
R4661:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4662:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4852:Atp4a	UTSW	7	30724268	missense	probably benign	0.10
R4892:Atp4a	UTSW	7	30712474	missense	probably benign	0.07
R4907:Atp4a	UTSW	7	30719092	missense	possibly damaging	0.66
R5024:Atp4a	UTSW	7	30715864	missense	possibly damaging	0.82
R5254:Atp4a	UTSW	7	30715530	missense	probably damaging	1.00
R5318:Atp4a	UTSW	7	30715329	missense	probably damaging	1.00
R5340:Atp4a	UTSW	7	30720806	missense	probably benign
R5484:Atp4a	UTSW	7	30720672	unclassified	probably benign
R5729:Atp4a	UTSW	7	30712426	missense	possibly damaging	0.48
R5762:Atp4a	UTSW	7	30719096	missense	probably damaging	0.99
R5797:Atp4a	UTSW	7	30712649	missense	probably damaging	1.00
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6077:Atp4a	UTSW	7	30715919	missense	probably benign	0.00
R6243:Atp4a	UTSW	7	30715957	missense	possibly damaging	0.68
R6459:Atp4a	UTSW	7	30712462	missense	probably benign	0.00
R6515:Atp4a	UTSW	7	30712478	missense	possibly damaging	0.78
R6773:Atp4a	UTSW	7	30715377	missense	probably damaging	0.98
R6854:Atp4a	UTSW	7	30715008	missense	probably benign	0.29
R7215:Atp4a	UTSW	7	30717360	missense	possibly damaging	0.61
R7271:Atp4a	UTSW	7	30722519	missense	probably benign	0.16
R7340:Atp4a	UTSW	7	30716730	missense	possibly damaging	0.94
R7457:Atp4a	UTSW	7	30720767	missense	probably benign	0.08
R7593:Atp4a	UTSW	7	30724680	missense	probably benign	0.08
R7712:Atp4a	UTSW	7	30715553	missense	probably damaging	0.96
R7762:Atp4a	UTSW	7	30720036	missense	probably damaging	0.96
R8714:Atp4a	UTSW	7	30720588	missense	probably damaging	0.99
R9324:Atp4a	UTSW	7	30715782	missense	probably benign	0.02
Z1177:Atp4a	UTSW	7	30717840	missense	possibly damaging	0.47
Z1186:Atp4a	UTSW	7	30717357	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGACACCTTGAGCCATCTCC -3'
(R):5'- CTCAAGGGGACTCTCATGTG -3'

Sequencing Primer
(F):5'- TGCCATCTTTAGGGGCCC -3'
(R):5'- AAGGGGACTCTCATGTGTACACTC -3'

Posted On

2018-04-27