Incidental Mutation 'R6346:Nup43'
ID513961
Institutional Source Beutler Lab
Gene Symbol Nup43
Ensembl Gene ENSMUSG00000040034
Gene Namenucleoporin 43
Synonymsp42, 43kDa, 2610529I12Rik, 2610016K01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R6346 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location7667503-7678881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7675062 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 232 (V232D)
Ref Sequence ENSEMBL: ENSMUSP00000046732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040135] [ENSMUST00000159977] [ENSMUST00000162682]
Predicted Effect probably damaging
Transcript: ENSMUST00000040135
AA Change: V232D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046732
Gene: ENSMUSG00000040034
AA Change: V232D

DomainStartEndE-ValueType
Blast:WD40 1 48 1e-15 BLAST
WD40 64 101 3.57e0 SMART
WD40 124 157 2.45e2 SMART
WD40 160 199 9.55e0 SMART
WD40 206 246 2.15e-4 SMART
WD40 250 290 2.19e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162527
Predicted Effect probably benign
Transcript: ENSMUST00000162682
SMART Domains Protein: ENSMUSP00000124246
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
Pfam:PCMT 1 66 7.5e-26 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bidirectional transport of macromolecules between the cytoplasm and nucleus occurs through nuclear pore complexes (NPCs) embedded in the nuclear envelope. NPCs are composed of subcomplexes, and NUP43 is part of one such subcomplex, Nup107-160 (Loiodice et al., 2004 [PubMed 15146057]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 C T 7: 75,685,254 S455L probably damaging Het
Apbb1ip T G 2: 22,866,993 probably null Het
Arhgap18 A T 10: 26,846,065 I11F probably damaging Het
Arl14epl A T 18: 46,926,342 N8I possibly damaging Het
Atp4a T A 7: 30,715,356 I190N possibly damaging Het
Bfar T C 16: 13,702,133 F285S probably damaging Het
Carf C T 1: 60,141,540 Q409* probably null Het
Cd244 T C 1: 171,577,321 V247A probably damaging Het
Ceacam12 T A 7: 18,069,401 I244K probably damaging Het
Cmya5 T C 13: 93,092,190 E2130G probably damaging Het
Cyp2b23 T G 7: 26,681,725 H69P probably damaging Het
Dixdc1 T C 9: 50,683,953 Q183R probably damaging Het
Dock10 T A 1: 80,575,856 probably null Het
Fam20c T C 5: 138,766,695 F279S probably damaging Het
Hcn4 C T 9: 58,859,044 T665I unknown Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Kdm7a A T 6: 39,151,211 probably null Het
Ksr1 A C 11: 79,019,664 L814R possibly damaging Het
Lmnb1 A G 18: 56,743,238 I473V probably benign Het
Mllt3 T C 4: 87,841,208 K201R probably damaging Het
Myo1b C T 1: 51,784,507 C413Y probably damaging Het
Myom3 A T 4: 135,806,051 N1185I probably benign Het
Nrde2 A G 12: 100,132,306 S701P probably benign Het
Ntn4 A T 10: 93,644,861 D112V probably damaging Het
Pcdha6 G A 18: 36,968,060 C102Y probably damaging Het
Pcdhgb8 T C 18: 37,762,078 L67P probably damaging Het
Pkd1l3 A G 8: 109,631,384 H836R probably damaging Het
Plekha1 T A 7: 130,877,782 I10N probably benign Het
Prss29 A G 17: 25,321,110 T161A possibly damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Secisbp2 C T 13: 51,679,887 H688Y probably damaging Het
Senp5 A G 16: 31,983,847 Y508H probably damaging Het
Shc3 T A 13: 51,451,615 T210S possibly damaging Het
Slc27a2 G A 2: 126,587,880 V467M probably damaging Het
Slc27a5 T A 7: 12,990,972 E487V possibly damaging Het
Snx1 T C 9: 66,094,648 T298A possibly damaging Het
Trir A G 8: 85,027,014 D39G possibly damaging Het
Ubd C T 17: 37,195,351 Q43* probably null Het
Ube2o T C 11: 116,541,368 E924G probably damaging Het
Vps13a T C 19: 16,682,214 I1650V possibly damaging Het
Xirp2 C A 2: 67,516,081 R2889S probably benign Het
Zfp804b T C 5: 6,770,534 E843G probably benign Het
Other mutations in Nup43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Nup43 APN 10 7669556 missense probably benign
IGL02029:Nup43 APN 10 7667583 missense possibly damaging 0.87
IGL02375:Nup43 APN 10 7673594 missense probably damaging 1.00
R0413:Nup43 UTSW 10 7671027 missense probably benign 0.05
R1061:Nup43 UTSW 10 7667671 missense probably damaging 0.99
R1892:Nup43 UTSW 10 7673609 missense probably damaging 0.99
R2960:Nup43 UTSW 10 7670949 missense probably benign
R3551:Nup43 UTSW 10 7675014 missense possibly damaging 0.93
R4772:Nup43 UTSW 10 7678669 nonsense probably null
R6179:Nup43 UTSW 10 7678673 missense probably benign 0.40
R8073:Nup43 UTSW 10 7670949 missense probably benign
R8220:Nup43 UTSW 10 7676333 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTAAGATTTAGTGTCTCCAGCCAC -3'
(R):5'- AGAGATTATCTGGCTTATACGGGC -3'

Sequencing Primer
(F):5'- GATTTAGTGTCTCCAGCCACATAAC -3'
(R):5'- GGCTTATACGGGCCAGATAC -3'
Posted On2018-04-27