Incidental Mutation 'R6346:Arhgap18'
ID513962
Institutional Source Beutler Lab
Gene Symbol Arhgap18
Ensembl Gene ENSMUSG00000039031
Gene NameRho GTPase activating protein 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6346 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location26753421-26918648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26846065 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 11 (I11F)
Ref Sequence ENSEMBL: ENSMUSP00000135783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039557] [ENSMUST00000135866] [ENSMUST00000176060]
Predicted Effect probably damaging
Transcript: ENSMUST00000039557
AA Change: I83F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044834
Gene: ENSMUSG00000039031
AA Change: I83F

DomainStartEndE-ValueType
low complexity region 100 114 N/A INTRINSIC
RhoGAP 340 520 8.99e-42 SMART
coiled coil region 535 557 N/A INTRINSIC
Blast:RhoGAP 572 613 1e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000135866
AA Change: I11F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135783
Gene: ENSMUSG00000039031
AA Change: I11F

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176060
AA Change: I11F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135030
Gene: ENSMUSG00000039031
AA Change: I11F

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
Meta Mutation Damage Score 0.3887 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP18 belongs to a family of Rho (see MIM 165390) GTPase-activating proteins that modulate cell signaling (Potkin et al., 2009 [PubMed 19065146]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 C T 7: 75,685,254 S455L probably damaging Het
Apbb1ip T G 2: 22,866,993 probably null Het
Arl14epl A T 18: 46,926,342 N8I possibly damaging Het
Atp4a T A 7: 30,715,356 I190N possibly damaging Het
Bfar T C 16: 13,702,133 F285S probably damaging Het
Carf C T 1: 60,141,540 Q409* probably null Het
Cd244 T C 1: 171,577,321 V247A probably damaging Het
Ceacam12 T A 7: 18,069,401 I244K probably damaging Het
Cmya5 T C 13: 93,092,190 E2130G probably damaging Het
Cyp2b23 T G 7: 26,681,725 H69P probably damaging Het
Dixdc1 T C 9: 50,683,953 Q183R probably damaging Het
Dock10 T A 1: 80,575,856 probably null Het
Fam20c T C 5: 138,766,695 F279S probably damaging Het
Hcn4 C T 9: 58,859,044 T665I unknown Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Kdm7a A T 6: 39,151,211 probably null Het
Ksr1 A C 11: 79,019,664 L814R possibly damaging Het
Lmnb1 A G 18: 56,743,238 I473V probably benign Het
Mllt3 T C 4: 87,841,208 K201R probably damaging Het
Myo1b C T 1: 51,784,507 C413Y probably damaging Het
Myom3 A T 4: 135,806,051 N1185I probably benign Het
Nrde2 A G 12: 100,132,306 S701P probably benign Het
Ntn4 A T 10: 93,644,861 D112V probably damaging Het
Nup43 T A 10: 7,675,062 V232D probably damaging Het
Pcdha6 G A 18: 36,968,060 C102Y probably damaging Het
Pcdhgb8 T C 18: 37,762,078 L67P probably damaging Het
Pkd1l3 A G 8: 109,631,384 H836R probably damaging Het
Plekha1 T A 7: 130,877,782 I10N probably benign Het
Prss29 A G 17: 25,321,110 T161A possibly damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Secisbp2 C T 13: 51,679,887 H688Y probably damaging Het
Senp5 A G 16: 31,983,847 Y508H probably damaging Het
Shc3 T A 13: 51,451,615 T210S possibly damaging Het
Slc27a2 G A 2: 126,587,880 V467M probably damaging Het
Slc27a5 T A 7: 12,990,972 E487V possibly damaging Het
Snx1 T C 9: 66,094,648 T298A possibly damaging Het
Trir A G 8: 85,027,014 D39G possibly damaging Het
Ubd C T 17: 37,195,351 Q43* probably null Het
Ube2o T C 11: 116,541,368 E924G probably damaging Het
Vps13a T C 19: 16,682,214 I1650V possibly damaging Het
Xirp2 C A 2: 67,516,081 R2889S probably benign Het
Zfp804b T C 5: 6,770,534 E843G probably benign Het
Other mutations in Arhgap18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Arhgap18 APN 10 26880748 missense possibly damaging 0.75
IGL02393:Arhgap18 APN 10 26877183 missense probably benign 0.07
IGL03368:Arhgap18 APN 10 26772693 missense possibly damaging 0.60
Half_pint UTSW 10 26772698 critical splice donor site probably null
R0698:Arhgap18 UTSW 10 26912629 missense probably damaging 1.00
R1456:Arhgap18 UTSW 10 26916440 missense probably benign 0.29
R1532:Arhgap18 UTSW 10 26860722 missense possibly damaging 0.69
R1768:Arhgap18 UTSW 10 26887861 missense probably damaging 1.00
R1768:Arhgap18 UTSW 10 26887862 missense probably damaging 1.00
R1793:Arhgap18 UTSW 10 26860736 unclassified probably benign
R1867:Arhgap18 UTSW 10 26846030 missense probably damaging 0.99
R2020:Arhgap18 UTSW 10 26854904 missense probably benign
R2049:Arhgap18 UTSW 10 26849942 missense probably benign 0.00
R2056:Arhgap18 UTSW 10 26854908 missense probably benign 0.03
R2058:Arhgap18 UTSW 10 26854908 missense probably benign 0.03
R2986:Arhgap18 UTSW 10 26854907 missense probably benign 0.00
R3027:Arhgap18 UTSW 10 26846096 missense probably benign
R5103:Arhgap18 UTSW 10 26869982 missense probably damaging 1.00
R5468:Arhgap18 UTSW 10 26912671 missense probably damaging 0.99
R5532:Arhgap18 UTSW 10 26846108 missense possibly damaging 0.56
R5710:Arhgap18 UTSW 10 26860733 splice site probably null
R6019:Arhgap18 UTSW 10 26860650 missense probably damaging 0.98
R6190:Arhgap18 UTSW 10 26846035 start codon destroyed probably null 0.22
R6438:Arhgap18 UTSW 10 26772698 critical splice donor site probably null
R6572:Arhgap18 UTSW 10 26846416 splice site probably null
R6799:Arhgap18 UTSW 10 26849921 missense possibly damaging 0.57
R6844:Arhgap18 UTSW 10 26772686 missense probably benign 0.04
R7051:Arhgap18 UTSW 10 26849921 missense possibly damaging 0.57
R7084:Arhgap18 UTSW 10 26872738 missense possibly damaging 0.77
R7727:Arhgap18 UTSW 10 26870011 missense possibly damaging 0.83
R8046:Arhgap18 UTSW 10 26887857 missense probably damaging 0.98
R8252:Arhgap18 UTSW 10 26854936 missense probably benign 0.00
R8392:Arhgap18 UTSW 10 26845940 missense probably benign 0.38
Z1088:Arhgap18 UTSW 10 26850004 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATGGTGCCAGTTCATCTGAAATG -3'
(R):5'- AACACGTGTACCTGGTATTTGG -3'

Sequencing Primer
(F):5'- GAACCACATTTTGTTTTGCTTTCAC -3'
(R):5'- ACCTGGTATTTGGACTCTTTTATCTG -3'
Posted On2018-04-27