Incidental Mutation 'R6346:Ntn4'
ID 513963
Institutional Source Beutler Lab
Gene Symbol Ntn4
Ensembl Gene ENSMUSG00000020019
Gene Name netrin 4
Synonyms beta-netrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6346 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 93640681-93747207 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 93644861 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 112 (D112V)
Ref Sequence ENSEMBL: ENSMUSP00000123306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020204] [ENSMUST00000147080]
AlphaFold Q9JI33
Predicted Effect probably damaging
Transcript: ENSMUST00000020204
AA Change: D149V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: D149V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 28 260 6.48e-55 SMART
EGF_Lam 262 329 5.83e-7 SMART
EGF_Lam 332 392 3.32e-11 SMART
EGF_Lam 395 446 3.73e-14 SMART
C345C 516 625 5.58e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147080
AA Change: D112V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123306
Gene: ENSMUSG00000020019
AA Change: D112V

DomainStartEndE-ValueType
LamNT 1 143 4.24e-12 SMART
Meta Mutation Damage Score 0.9595 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 C T 7: 75,685,254 S455L probably damaging Het
Apbb1ip T G 2: 22,866,993 probably null Het
Arhgap18 A T 10: 26,846,065 I11F probably damaging Het
Arl14epl A T 18: 46,926,342 N8I possibly damaging Het
Atp4a T A 7: 30,715,356 I190N possibly damaging Het
Bfar T C 16: 13,702,133 F285S probably damaging Het
Carf C T 1: 60,141,540 Q409* probably null Het
Cd244 T C 1: 171,577,321 V247A probably damaging Het
Ceacam12 T A 7: 18,069,401 I244K probably damaging Het
Cmya5 T C 13: 93,092,190 E2130G probably damaging Het
Cyp2b23 T G 7: 26,681,725 H69P probably damaging Het
Dixdc1 T C 9: 50,683,953 Q183R probably damaging Het
Dock10 T A 1: 80,575,856 probably null Het
Fam20c T C 5: 138,766,695 F279S probably damaging Het
Hcn4 C T 9: 58,859,044 T665I unknown Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Kdm7a A T 6: 39,151,211 probably null Het
Ksr1 A C 11: 79,019,664 L814R possibly damaging Het
Lmnb1 A G 18: 56,743,238 I473V probably benign Het
Mllt3 T C 4: 87,841,208 K201R probably damaging Het
Myo1b C T 1: 51,784,507 C413Y probably damaging Het
Myom3 A T 4: 135,806,051 N1185I probably benign Het
Nrde2 A G 12: 100,132,306 S701P probably benign Het
Nup43 T A 10: 7,675,062 V232D probably damaging Het
Pcdha6 G A 18: 36,968,060 C102Y probably damaging Het
Pcdhgb8 T C 18: 37,762,078 L67P probably damaging Het
Pkd1l3 A G 8: 109,631,384 H836R probably damaging Het
Plekha1 T A 7: 130,877,782 I10N probably benign Het
Prss29 A G 17: 25,321,110 T161A possibly damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Secisbp2 C T 13: 51,679,887 H688Y probably damaging Het
Senp5 A G 16: 31,983,847 Y508H probably damaging Het
Shc3 T A 13: 51,451,615 T210S possibly damaging Het
Slc27a2 G A 2: 126,587,880 V467M probably damaging Het
Slc27a5 T A 7: 12,990,972 E487V possibly damaging Het
Snx1 T C 9: 66,094,648 T298A possibly damaging Het
Trir A G 8: 85,027,014 D39G possibly damaging Het
Ubd C T 17: 37,195,351 Q43* probably null Het
Ube2o T C 11: 116,541,368 E924G probably damaging Het
Vps13a T C 19: 16,682,214 I1650V possibly damaging Het
Xirp2 C A 2: 67,516,081 R2889S probably benign Het
Zfp804b T C 5: 6,770,534 E843G probably benign Het
Other mutations in Ntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Ntn4 APN 10 93707349 missense probably damaging 1.00
IGL02212:Ntn4 APN 10 93644849 missense possibly damaging 0.50
IGL02698:Ntn4 APN 10 93644659 missense probably benign 0.19
IGL02752:Ntn4 APN 10 93710559 missense possibly damaging 0.84
PIT4468001:Ntn4 UTSW 10 93644725 missense probably damaging 0.99
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0132:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0419:Ntn4 UTSW 10 93682429 missense probably benign 0.04
R1304:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1306:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1307:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1308:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1619:Ntn4 UTSW 10 93644734 missense probably damaging 1.00
R1645:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1664:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1695:Ntn4 UTSW 10 93733602 splice site probably null
R1796:Ntn4 UTSW 10 93745771 missense probably damaging 1.00
R1806:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1845:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1856:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1872:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1879:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1901:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1902:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1925:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1926:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1927:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2060:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2113:Ntn4 UTSW 10 93644839 missense probably damaging 1.00
R2202:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2203:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2975:Ntn4 UTSW 10 93644891 missense probably damaging 1.00
R4277:Ntn4 UTSW 10 93741210 missense possibly damaging 0.95
R4805:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R4806:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R4807:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R5818:Ntn4 UTSW 10 93644764 missense probably benign 0.40
R6048:Ntn4 UTSW 10 93707266 splice site probably null
R6051:Ntn4 UTSW 10 93745795 missense probably benign
R6752:Ntn4 UTSW 10 93734175 missense probably benign
R7196:Ntn4 UTSW 10 93733714 missense probably benign 0.01
R7240:Ntn4 UTSW 10 93745741 missense probably damaging 0.99
R7365:Ntn4 UTSW 10 93644804 missense probably damaging 1.00
R7374:Ntn4 UTSW 10 93682572 missense probably benign
R7505:Ntn4 UTSW 10 93707284 missense probably damaging 1.00
R7509:Ntn4 UTSW 10 93710568 missense probably benign 0.01
R7726:Ntn4 UTSW 10 93733682 missense possibly damaging 0.82
R7957:Ntn4 UTSW 10 93644473 splice site probably benign
R8092:Ntn4 UTSW 10 93741056 missense probably damaging 0.97
R8202:Ntn4 UTSW 10 93644903 missense possibly damaging 0.88
R8508:Ntn4 UTSW 10 93741104 missense possibly damaging 0.48
R9010:Ntn4 UTSW 10 93644644 missense
R9115:Ntn4 UTSW 10 93733813 missense probably benign
R9415:Ntn4 UTSW 10 93644626 missense probably benign 0.00
RF045:Ntn4 UTSW 10 93710625 missense possibly damaging 0.95
X0024:Ntn4 UTSW 10 93644971 missense probably damaging 1.00
Z1176:Ntn4 UTSW 10 93741153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGCCCAAGTGTGATAAATG -3'
(R):5'- TCCTTATGGTGCAGAGTTAAACACG -3'

Sequencing Primer
(F):5'- CCAAGTGTGATAAATGCAACGCTG -3'
(R):5'- TGCAGAGTTAAACACGTGCTC -3'
Posted On 2018-04-27