Incidental Mutation 'R6346:Senp5'
ID513972
Institutional Source Beutler Lab
Gene Symbol Senp5
Ensembl Gene ENSMUSG00000022772
Gene NameSUMO/sentrin specific peptidase 5
Synonyms6230429P13Rik, A730063F07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6346 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location31959672-32003287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31983847 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 508 (Y508H)
Ref Sequence ENSEMBL: ENSMUSP00000156109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023457] [ENSMUST00000129900] [ENSMUST00000155515] [ENSMUST00000231360]
Predicted Effect probably damaging
Transcript: ENSMUST00000023457
AA Change: Y508H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023457
Gene: ENSMUSG00000022772
AA Change: Y508H

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
Pfam:Peptidase_C48 575 747 3.9e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121984
Predicted Effect probably damaging
Transcript: ENSMUST00000129900
AA Change: Y481H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115257
Gene: ENSMUSG00000022772
AA Change: Y481H

DomainStartEndE-ValueType
low complexity region 414 425 N/A INTRINSIC
Pfam:Peptidase_C48 548 603 5.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144320
Predicted Effect probably damaging
Transcript: ENSMUST00000155515
AA Change: Y89H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117481
Gene: ENSMUSG00000022772
AA Change: Y89H

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:Peptidase_C48 156 208 2.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180144
Predicted Effect probably damaging
Transcript: ENSMUST00000231360
AA Change: Y508H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232628
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The reversible posttranslational modification of proteins by the addition of small ubiquitin-like SUMO proteins (see SUMO1; MIM 601912) is required for numerous biologic processes. SUMO-specific proteases, such as SENP5, are responsible for the initial processing of SUMO precursors to generate a C-terminal diglycine motif required for the conjugation reaction. They also have isopeptidase activity for the removal of SUMO from high molecular mass SUMO conjugates (Di Bacco et al., 2006 [PubMed 16738315]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 C T 7: 75,685,254 S455L probably damaging Het
Apbb1ip T G 2: 22,866,993 probably null Het
Arhgap18 A T 10: 26,846,065 I11F probably damaging Het
Arl14epl A T 18: 46,926,342 N8I possibly damaging Het
Atp4a T A 7: 30,715,356 I190N possibly damaging Het
Bfar T C 16: 13,702,133 F285S probably damaging Het
Carf C T 1: 60,141,540 Q409* probably null Het
Cd244 T C 1: 171,577,321 V247A probably damaging Het
Ceacam12 T A 7: 18,069,401 I244K probably damaging Het
Cmya5 T C 13: 93,092,190 E2130G probably damaging Het
Cyp2b23 T G 7: 26,681,725 H69P probably damaging Het
Dixdc1 T C 9: 50,683,953 Q183R probably damaging Het
Dock10 T A 1: 80,575,856 probably null Het
Fam20c T C 5: 138,766,695 F279S probably damaging Het
Hcn4 C T 9: 58,859,044 T665I unknown Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Kdm7a A T 6: 39,151,211 probably null Het
Ksr1 A C 11: 79,019,664 L814R possibly damaging Het
Lmnb1 A G 18: 56,743,238 I473V probably benign Het
Mllt3 T C 4: 87,841,208 K201R probably damaging Het
Myo1b C T 1: 51,784,507 C413Y probably damaging Het
Myom3 A T 4: 135,806,051 N1185I probably benign Het
Nrde2 A G 12: 100,132,306 S701P probably benign Het
Ntn4 A T 10: 93,644,861 D112V probably damaging Het
Nup43 T A 10: 7,675,062 V232D probably damaging Het
Pcdha6 G A 18: 36,968,060 C102Y probably damaging Het
Pcdhgb8 T C 18: 37,762,078 L67P probably damaging Het
Pkd1l3 A G 8: 109,631,384 H836R probably damaging Het
Plekha1 T A 7: 130,877,782 I10N probably benign Het
Prss29 A G 17: 25,321,110 T161A possibly damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Secisbp2 C T 13: 51,679,887 H688Y probably damaging Het
Shc3 T A 13: 51,451,615 T210S possibly damaging Het
Slc27a2 G A 2: 126,587,880 V467M probably damaging Het
Slc27a5 T A 7: 12,990,972 E487V possibly damaging Het
Snx1 T C 9: 66,094,648 T298A possibly damaging Het
Trir A G 8: 85,027,014 D39G possibly damaging Het
Ubd C T 17: 37,195,351 Q43* probably null Het
Ube2o T C 11: 116,541,368 E924G probably damaging Het
Vps13a T C 19: 16,682,214 I1650V possibly damaging Het
Xirp2 C A 2: 67,516,081 R2889S probably benign Het
Zfp804b T C 5: 6,770,534 E843G probably benign Het
Other mutations in Senp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Senp5 APN 16 31989173 missense probably damaging 1.00
IGL00990:Senp5 APN 16 31990274 missense probably benign 0.00
IGL01707:Senp5 APN 16 31989770 missense probably damaging 0.99
IGL01923:Senp5 APN 16 31965816 missense probably damaging 1.00
IGL01997:Senp5 APN 16 31963470 missense probably damaging 0.97
IGL02273:Senp5 APN 16 31989872 missense probably benign 0.14
IGL02560:Senp5 APN 16 31989392 missense probably benign
IGL02651:Senp5 APN 16 31990079 missense probably benign 0.04
IGL02830:Senp5 APN 16 31983485 splice site probably benign
R0578:Senp5 UTSW 16 31989345 missense possibly damaging 0.75
R1879:Senp5 UTSW 16 31983824 missense probably damaging 1.00
R2153:Senp5 UTSW 16 31968874 missense probably damaging 1.00
R4903:Senp5 UTSW 16 31983299 missense probably damaging 1.00
R5092:Senp5 UTSW 16 31989142 missense probably benign 0.00
R5590:Senp5 UTSW 16 31989513 missense probably damaging 0.99
R6362:Senp5 UTSW 16 31989884 missense probably damaging 0.99
R6762:Senp5 UTSW 16 31989884 missense probably damaging 0.99
R7002:Senp5 UTSW 16 31983775 missense probably damaging 1.00
R7027:Senp5 UTSW 16 31989295 missense probably benign
R7436:Senp5 UTSW 16 31976029 missense unknown
R7721:Senp5 UTSW 16 31990434 start codon destroyed unknown
R7847:Senp5 UTSW 16 31990173 missense probably benign 0.25
R7930:Senp5 UTSW 16 31990173 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ACTTTTGATGTCTGGCCCGG -3'
(R):5'- CTTCATGGGTTACAAAGGTGAAGG -3'

Sequencing Primer
(F):5'- GGCCCGGTAGTTTGTTATTTCCC -3'
(R):5'- GGCTCTATGCTCTCTGTA -3'
Posted On2018-04-27