Incidental Mutation 'R6346:Lmnb1'
ID513978
Institutional Source Beutler Lab
Gene Symbol Lmnb1
Ensembl Gene ENSMUSG00000024590
Gene Namelamin B1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6346 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location56707813-56753424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56743238 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 473 (I473V)
Ref Sequence ENSEMBL: ENSMUSP00000025486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025486]
Predicted Effect probably benign
Transcript: ENSMUST00000025486
AA Change: I473V

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025486
Gene: ENSMUSG00000024590
AA Change: I473V

DomainStartEndE-ValueType
Filament 32 388 2.59e-47 SMART
low complexity region 392 414 N/A INTRINSIC
Pfam:LTD 436 546 2.3e-18 PFAM
low complexity region 551 570 N/A INTRINSIC
Meta Mutation Damage Score 0.0857 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the two B-type lamin proteins and is a component of the nuclear lamina. A duplication of this gene is associated with autosomal dominant adult-onset leukodystrophy (ADLD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mice display neonatal lethality with respiratory distress, abnormal lung, craniofacial, and skeletal morphology, reduced embryo size, impaired cellular proliferation and differentiation, and abnormal nuclear morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 C T 7: 75,685,254 S455L probably damaging Het
Apbb1ip T G 2: 22,866,993 probably null Het
Arhgap18 A T 10: 26,846,065 I11F probably damaging Het
Arl14epl A T 18: 46,926,342 N8I possibly damaging Het
Atp4a T A 7: 30,715,356 I190N possibly damaging Het
Bfar T C 16: 13,702,133 F285S probably damaging Het
Carf C T 1: 60,141,540 Q409* probably null Het
Cd244 T C 1: 171,577,321 V247A probably damaging Het
Ceacam12 T A 7: 18,069,401 I244K probably damaging Het
Cmya5 T C 13: 93,092,190 E2130G probably damaging Het
Cyp2b23 T G 7: 26,681,725 H69P probably damaging Het
Dixdc1 T C 9: 50,683,953 Q183R probably damaging Het
Dock10 T A 1: 80,575,856 probably null Het
Fam20c T C 5: 138,766,695 F279S probably damaging Het
Hcn4 C T 9: 58,859,044 T665I unknown Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Kdm7a A T 6: 39,151,211 probably null Het
Ksr1 A C 11: 79,019,664 L814R possibly damaging Het
Mllt3 T C 4: 87,841,208 K201R probably damaging Het
Myo1b C T 1: 51,784,507 C413Y probably damaging Het
Myom3 A T 4: 135,806,051 N1185I probably benign Het
Nrde2 A G 12: 100,132,306 S701P probably benign Het
Ntn4 A T 10: 93,644,861 D112V probably damaging Het
Nup43 T A 10: 7,675,062 V232D probably damaging Het
Pcdha6 G A 18: 36,968,060 C102Y probably damaging Het
Pcdhgb8 T C 18: 37,762,078 L67P probably damaging Het
Pkd1l3 A G 8: 109,631,384 H836R probably damaging Het
Plekha1 T A 7: 130,877,782 I10N probably benign Het
Prss29 A G 17: 25,321,110 T161A possibly damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Secisbp2 C T 13: 51,679,887 H688Y probably damaging Het
Senp5 A G 16: 31,983,847 Y508H probably damaging Het
Shc3 T A 13: 51,451,615 T210S possibly damaging Het
Slc27a2 G A 2: 126,587,880 V467M probably damaging Het
Slc27a5 T A 7: 12,990,972 E487V possibly damaging Het
Snx1 T C 9: 66,094,648 T298A possibly damaging Het
Trir A G 8: 85,027,014 D39G possibly damaging Het
Ubd C T 17: 37,195,351 Q43* probably null Het
Ube2o T C 11: 116,541,368 E924G probably damaging Het
Vps13a T C 19: 16,682,214 I1650V possibly damaging Het
Xirp2 C A 2: 67,516,081 R2889S probably benign Het
Zfp804b T C 5: 6,770,534 E843G probably benign Het
Other mutations in Lmnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01536:Lmnb1 APN 18 56740796 missense probably benign 0.37
IGL02139:Lmnb1 APN 18 56749799 missense probably benign 0.00
Katmai UTSW 18 56743276 nonsense probably null
R0446:Lmnb1 UTSW 18 56743259 missense probably benign 0.02
R0696:Lmnb1 UTSW 18 56740721 missense probably damaging 0.99
R1308:Lmnb1 UTSW 18 56728475 missense probably benign 0.06
R1309:Lmnb1 UTSW 18 56739904 frame shift probably null
R1544:Lmnb1 UTSW 18 56749751 missense probably benign 0.08
R2680:Lmnb1 UTSW 18 56731105 missense probably damaging 1.00
R3833:Lmnb1 UTSW 18 56728526 missense probably benign 0.01
R3980:Lmnb1 UTSW 18 56731019 missense probably damaging 1.00
R5820:Lmnb1 UTSW 18 56740786 missense possibly damaging 0.70
R6025:Lmnb1 UTSW 18 56729384 nonsense probably null
R6028:Lmnb1 UTSW 18 56743276 nonsense probably null
R6736:Lmnb1 UTSW 18 56728469 missense probably damaging 1.00
R8013:Lmnb1 UTSW 18 56708359 missense probably damaging 1.00
RF004:Lmnb1 UTSW 18 56730974 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGACCGTGATCCTTGCTTG -3'
(R):5'- AATGCTTCTCTTTCGGTCAAAC -3'

Sequencing Primer
(F):5'- CAGTTTTGTCCCCTTTAAAATTCAG -3'
(R):5'- CCTCTTCTGGAGTGTCTGAAAACAG -3'
Posted On2018-04-27