Incidental Mutation 'R6343:Car2'
ID513985
Institutional Source Beutler Lab
Gene Symbol Car2
Ensembl Gene ENSMUSG00000027562
Gene Namecarbonic anhydrase 2
SynonymsCar-2, Ltw-5, CAII, Lvtw-5, CA II
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.466) question?
Stock #R6343 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location14886273-14900770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14887965 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 56 (S56P)
Ref Sequence ENSEMBL: ENSMUSP00000141876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029078] [ENSMUST00000192609]
Predicted Effect probably benign
Transcript: ENSMUST00000029078
AA Change: S56P

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000029078
Gene: ENSMUSG00000027562
AA Change: S56P

DomainStartEndE-ValueType
Carb_anhydrase 5 259 1.2e-136 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192609
AA Change: S56P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141876
Gene: ENSMUSG00000027562
AA Change: S56P

DomainStartEndE-ValueType
Carb_anhydrase 5 115 8.2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195520
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of several isozymes of carbonic anhydrase, which catalyzes reversible hydration of carbon dioxide. Defects in this enzyme are associated with osteopetrosis and renal tubular acidosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygous mutant mice are growth retarded, display renal tubular acidosis, but mutants have not been recovered that display osteopetrosis as found in human CA-II deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,314,552 L301Q probably damaging Het
Adgrl4 T C 3: 151,517,806 L632P probably damaging Het
Cacna2d1 T A 5: 16,322,564 I539N probably benign Het
Camta1 T A 4: 151,079,849 H314L probably damaging Het
Chrm5 G A 2: 112,479,448 A441V probably damaging Het
Ckap5 T A 2: 91,596,474 N1380K possibly damaging Het
Cspg4 T C 9: 56,892,692 V1580A probably benign Het
Dcc A G 18: 71,336,035 L1099P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha5 A T 5: 84,106,747 H644Q probably damaging Het
Eya3 T C 4: 132,672,910 I80T probably damaging Het
Fdft1 A T 14: 63,151,272 Y304N probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Gpatch2l T A 12: 86,260,605 Y252* probably null Het
Hivep1 G T 13: 42,159,671 G1796* probably null Het
Irf8 T C 8: 120,753,707 V228A probably damaging Het
Islr A C 9: 58,157,096 V376G probably damaging Het
Kdm5a T C 6: 120,382,933 V230A probably benign Het
Lpgat1 A G 1: 191,776,572 probably null Het
Lrp8 T C 4: 107,869,156 probably null Het
Lyzl4 A C 9: 121,578,084 S127A possibly damaging Het
Map4k1 T C 7: 29,000,290 V606A possibly damaging Het
Mau2 T A 8: 70,031,523 K138N probably damaging Het
Meikin T C 11: 54,370,766 L33P probably damaging Het
Mrpl28 T C 17: 26,126,278 V224A probably benign Het
Ncdn T C 4: 126,747,171 D512G possibly damaging Het
Nlrp2 T A 7: 5,300,926 Q200L possibly damaging Het
Nup98 T C 7: 102,194,750 N89S possibly damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 G T 19: 12,919,582 H242Q probably damaging Het
Olfr304 T A 7: 86,385,851 R270* probably null Het
Olfr551 A G 7: 102,588,546 C66R probably damaging Het
Olfr770 A T 10: 129,133,666 L34* probably null Het
Padi3 C T 4: 140,803,508 V68I possibly damaging Het
Pign A T 1: 105,585,095 M621K probably benign Het
Pigv C T 4: 133,665,236 V208M probably damaging Het
Ripk4 A G 16: 97,763,526 probably null Het
Rsf1 A G 7: 97,660,917 K285E probably benign Het
Serpina3k G C 12: 104,345,303 G380A probably benign Het
Sorbs1 A G 19: 40,376,982 probably null Het
Srrd G C 5: 112,340,000 A104G probably benign Het
Tbp T A 17: 15,501,089 probably null Het
Tecrl G A 5: 83,294,600 H209Y probably damaging Het
Tmprss11c A G 5: 86,256,345 L157P probably damaging Het
Tmprss13 A T 9: 45,343,200 T422S possibly damaging Het
Ttll5 A G 12: 85,956,699 H1103R probably benign Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vldlr A G 19: 27,245,649 Y699C probably damaging Het
Vmn1r22 T G 6: 57,900,578 N138T possibly damaging Het
Other mutations in Car2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Car2 APN 3 14895628 critical splice donor site probably null
IGL02618:Car2 APN 3 14897972 missense probably benign 0.00
IGL03247:Car2 APN 3 14887939 missense probably damaging 1.00
IGL03342:Car2 APN 3 14895569 missense probably benign 0.21
R0257:Car2 UTSW 3 14899977 missense probably benign 0.00
R1260:Car2 UTSW 3 14895580 missense probably damaging 1.00
R4409:Car2 UTSW 3 14895102 missense probably damaging 1.00
R4527:Car2 UTSW 3 14898005 missense probably damaging 1.00
R4681:Car2 UTSW 3 14895564 nonsense probably null
R5677:Car2 UTSW 3 14898055 missense possibly damaging 0.92
R6530:Car2 UTSW 3 14896731 missense probably benign 0.05
R6786:Car2 UTSW 3 14886650 start gained probably benign
R7010:Car2 UTSW 3 14900053 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TAGAAACACCAGTGGCTTCC -3'
(R):5'- ACATCTCAGCTTTCGGACAC -3'

Sequencing Primer
(F):5'- ACCAGTGGCTTCCGGTGG -3'
(R):5'- CTCAGCTTTCGGACACAAATTG -3'
Posted On2018-04-27